-
https://repository.netecweb.org/files/original/8c627eb47eeafb833f978b68c2c18f6c.png
ffa8193d03702a0b82a1a1ca19b763a4
Dublin Core
The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.
Title
A name given to the resource
Discover
Description
An account of the resource
<div style="background-color:#c7e5f8;">
<h2 style="background-color:#c7e5f8;"><span style="font-size:80%;line-height:24px;"><a href="https://repository.netecweb.org/exhibits/show/ncov/ncov"><button>COVID-19 Update</button></a><a href="https://repository.netecweb.org/news#Map"><button>Outbreak Map</button></a><a href="https://repository.netecweb.org/news#News"><button>Newsfeed</button></a><a href="https://repository.netecweb.org/exhibits/show/monkeypox/monkeypox"><button>Monkeypox 2021</button></a><a href="https://repository.netecweb.org/exhibits/show/drcebola2018/drcebola2018"><button>2020 Ebola Update</button></a><a href="https://repository.netecweb.org/ebolatimeline"><button>Ebola Timeline</button></a><a href="https://repository.netecweb.org/exhibits/show/mers/mers"><button>MERS</button></a><a href="https://repository.netecweb.org/exhibits/show/aerosol/aerosol"><button>Airborne Transmission</button></a></span></h2>
<h2 style="background-color:#c7e5f8;">Discover Background Data and Resources:</h2>
<ul><li>
<p><span style="line-height:24px;">Get introduced to NETEC through the interactive timeline of special pathogens below.* This timeline describes some significant special pathogen events in recent history.</span></p>
</li>
<li>
<p><span style="line-height:24px;">Find out more about the 2014 Ebola outbreak and the development of the ASPR/CDC-supported network of healthcare facilities preparing for the next outbreak through <em><a href="/ebolatimeline"><button>the Ebola timeline</button></a>.</em></span></p>
</li>
</ul><ul><li>
<p><span style="line-height:24px;">This NETEC Repository helps to provide training and educational resources to prepare for future special pathogen events. </span></p>
</li>
</ul><ul><li>
<p><span style="line-height:24px;">Explore the files BELOW THE TIMELINE to <em><strong>discover and learn</strong></em> more about Ebola and other Special Pathogens, an overview of special pathogens, clinically managing patients affected, and readying healthcare teams and systems to keep everyone safe.</span></p>
</li>
</ul><h2 style="background-color:#c7e5f8;">Timeline of Special Pathogens:</h2>
<a href="#click">Skip timeline</a>
<p style="margin-bottom:0;"><iframe width="100%" height="635" style="border:1px solid #000000;" src="https://cdn.knightlab.com/libs/timeline3/latest/embed/index.html?source=1AQiHJEzkhEi71uIi7wTWWgSFRwR6wRbRyfhbASrw3Ig&font=Default&lang=en&initial_zoom=2&height=650" title="Timeline of Special Pathogens"></iframe></p>
<h2 style="background-color:#c7e5f8;"><span style="font-size:70%;">*Click for <a href="/timeline2access"><button>a screen reader accessible table of this timeline</button></a>. </span></h2>
</div>
Online Course
Access portal to an online course.
Objectives
<h2>What you will learn</h2>
<p>By the end of this training, you will be able to:</p>
<ul>
<li>Describe at least two risk factors of Lassa fever.</li>
<li>Name at least two countries where Lassa fever is endemic.</li>
<li>Describe at least five signs or symptoms of Lassa fever.</li>
<li>Describe the implications of Lassa fever infection on pregnant women.</li>
<li>Describe the clinical syndrome associated with Lassa fever in children.</li>
<li>Describe my role, responsibilities, and scope of practice as a team member when diagnosing Lassa fever.</li>
</ul>
URL
https://www.cdc.gov/vhf/lassa/resources/training/training-medical-provider.html
Alternate URL
Other URLs if necessary.
https://www.cdc.gov/vhf/lassa/resources/index.html
Dublin Core
The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.
Title
A name given to the resource
The Epidemiology and Clinical Presentation of Lassa Fever: Information for Medical Providers
Subject
The topic of the resource
Training and Exercises
Description
An account of the resource
<h2>Learn to Identify Lassa Fever</h2>
<p>While viral hemorrhagic fevers (VHFs), like Lassa fever, are very serious, they are not common in the U.S. However, it is important for healthcare providers to understand high consequence viruses, like Lassa fever, so they can appropriately diagnose and care for their patients. This video, the first in a two-part training series on Lassa fever, provides an overview, describing the epidemiology and clinical presentation of the virus.</p>
Creator
An entity primarily responsible for making the resource
CDC
Date
A point or period of time associated with an event in the lifecycle of the resource
2019-01-31
Contributor
An entity responsible for making contributions to the resource
2023-10-17 by Darrell Ruby, T&E group
Coverage
The spatial or temporal topic of the resource, the spatial applicability of the resource, or the jurisdiction under which the resource is relevant
2025-10-17
Clinical Care
Epidemiology
Lassa
R-Lead
R-T&E
Training
-
https://repository.netecweb.org/files/original/be3c1f11cef0bce53de0e22bdd323017.png
ffa8193d03702a0b82a1a1ca19b763a4
Dublin Core
The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.
Title
A name given to the resource
Discover
Description
An account of the resource
<div style="background-color:#c7e5f8;">
<h2 style="background-color:#c7e5f8;"><span style="font-size:80%;line-height:24px;"><a href="https://repository.netecweb.org/exhibits/show/ncov/ncov"><button>COVID-19 Update</button></a><a href="https://repository.netecweb.org/news#Map"><button>Outbreak Map</button></a><a href="https://repository.netecweb.org/news#News"><button>Newsfeed</button></a><a href="https://repository.netecweb.org/exhibits/show/monkeypox/monkeypox"><button>Monkeypox 2021</button></a><a href="https://repository.netecweb.org/exhibits/show/drcebola2018/drcebola2018"><button>2020 Ebola Update</button></a><a href="https://repository.netecweb.org/ebolatimeline"><button>Ebola Timeline</button></a><a href="https://repository.netecweb.org/exhibits/show/mers/mers"><button>MERS</button></a><a href="https://repository.netecweb.org/exhibits/show/aerosol/aerosol"><button>Airborne Transmission</button></a></span></h2>
<h2 style="background-color:#c7e5f8;">Discover Background Data and Resources:</h2>
<ul><li>
<p><span style="line-height:24px;">Get introduced to NETEC through the interactive timeline of special pathogens below.* This timeline describes some significant special pathogen events in recent history.</span></p>
</li>
<li>
<p><span style="line-height:24px;">Find out more about the 2014 Ebola outbreak and the development of the ASPR/CDC-supported network of healthcare facilities preparing for the next outbreak through <em><a href="/ebolatimeline"><button>the Ebola timeline</button></a>.</em></span></p>
</li>
</ul><ul><li>
<p><span style="line-height:24px;">This NETEC Repository helps to provide training and educational resources to prepare for future special pathogen events. </span></p>
</li>
</ul><ul><li>
<p><span style="line-height:24px;">Explore the files BELOW THE TIMELINE to <em><strong>discover and learn</strong></em> more about Ebola and other Special Pathogens, an overview of special pathogens, clinically managing patients affected, and readying healthcare teams and systems to keep everyone safe.</span></p>
</li>
</ul><h2 style="background-color:#c7e5f8;">Timeline of Special Pathogens:</h2>
<a href="#click">Skip timeline</a>
<p style="margin-bottom:0;"><iframe width="100%" height="635" style="border:1px solid #000000;" src="https://cdn.knightlab.com/libs/timeline3/latest/embed/index.html?source=1AQiHJEzkhEi71uIi7wTWWgSFRwR6wRbRyfhbASrw3Ig&font=Default&lang=en&initial_zoom=2&height=650" title="Timeline of Special Pathogens"></iframe></p>
<h2 style="background-color:#c7e5f8;"><span style="font-size:70%;">*Click for <a href="/timeline2access"><button>a screen reader accessible table of this timeline</button></a>. </span></h2>
</div>
Online Course
Access portal to an online course.
Objectives
<h2>What you will learn</h2>
<ul>
<li>Describe at least two methods for identifying a patient with Lassa fever infection in the clinical setting.</li>
<li>Describe at least two infection control recommendations when caring for a Lassa fever patient.</li>
<li>Identify the parameters for clinical management of patients with Lassa fever.</li>
<li>Describe post-exposure prophylaxis (PEP) for Lassa fever.</li>
<li>Describe my role, responsibility, and scope of practice as a team member in diagnosing and treating patients with Lassa fever.</li>
</ul>
<br />
<p>This activity provides 0.3 contact hours.</p>
URL
https://www.cdc.gov/vhf/lassa/resources/training/training-diagnosis-treat.html
Alternate URL
Other URLs if necessary.
https://www.cdc.gov/vhf/lassa/resources/index.html
Dublin Core
The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.
Title
A name given to the resource
Diagnose and Treat Lassa Fever Video Training: Information for Medical Providers
Subject
The topic of the resource
Training and Exercises
Description
An account of the resource
<h2>Learn to diagnose and treat Lassa fever</h2>
<p>While viral hemorrhagic fevers (VHFs), like Lassa fever, are very serious, they are not common in the U.S. However, it is important for healthcare providers to understand high consequence viruses, like Lassa fever, so they can appropriately diagnose and care for their patients. This video is the second in a two-part training series on Lassa fever for healthcare providers. It focuses on methods for diagnosing Lassa fever and infection control measures to consider while caring for a patient with Lassa fever. Participants will learn about treatment options, as well as post-exposure prophylaxis (PEP).</p>
Creator
An entity primarily responsible for making the resource
CDC
Date
A point or period of time associated with an event in the lifecycle of the resource
2019-01-31
Contributor
An entity responsible for making contributions to the resource
2023-10-17 by Darrell Ruby, T&E group
Coverage
The spatial or temporal topic of the resource, the spatial applicability of the resource, or the jurisdiction under which the resource is relevant
2025-10-17
Clinical Care
Diagnosis
Lassa
Patient Care
R-Lead
R-T&E
Training
-
https://repository.netecweb.org/files/original/607ee2e42db412045f366f2de4ad78b4.png
ffa8193d03702a0b82a1a1ca19b763a4
Dublin Core
The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.
Title
A name given to the resource
Discover
Description
An account of the resource
<div style="background-color:#c7e5f8;">
<h2 style="background-color:#c7e5f8;"><span style="font-size:80%;line-height:24px;"><a href="https://repository.netecweb.org/exhibits/show/ncov/ncov"><button>COVID-19 Update</button></a><a href="https://repository.netecweb.org/news#Map"><button>Outbreak Map</button></a><a href="https://repository.netecweb.org/news#News"><button>Newsfeed</button></a><a href="https://repository.netecweb.org/exhibits/show/monkeypox/monkeypox"><button>Monkeypox 2021</button></a><a href="https://repository.netecweb.org/exhibits/show/drcebola2018/drcebola2018"><button>2020 Ebola Update</button></a><a href="https://repository.netecweb.org/ebolatimeline"><button>Ebola Timeline</button></a><a href="https://repository.netecweb.org/exhibits/show/mers/mers"><button>MERS</button></a><a href="https://repository.netecweb.org/exhibits/show/aerosol/aerosol"><button>Airborne Transmission</button></a></span></h2>
<h2 style="background-color:#c7e5f8;">Discover Background Data and Resources:</h2>
<ul><li>
<p><span style="line-height:24px;">Get introduced to NETEC through the interactive timeline of special pathogens below.* This timeline describes some significant special pathogen events in recent history.</span></p>
</li>
<li>
<p><span style="line-height:24px;">Find out more about the 2014 Ebola outbreak and the development of the ASPR/CDC-supported network of healthcare facilities preparing for the next outbreak through <em><a href="/ebolatimeline"><button>the Ebola timeline</button></a>.</em></span></p>
</li>
</ul><ul><li>
<p><span style="line-height:24px;">This NETEC Repository helps to provide training and educational resources to prepare for future special pathogen events. </span></p>
</li>
</ul><ul><li>
<p><span style="line-height:24px;">Explore the files BELOW THE TIMELINE to <em><strong>discover and learn</strong></em> more about Ebola and other Special Pathogens, an overview of special pathogens, clinically managing patients affected, and readying healthcare teams and systems to keep everyone safe.</span></p>
</li>
</ul><h2 style="background-color:#c7e5f8;">Timeline of Special Pathogens:</h2>
<a href="#click">Skip timeline</a>
<p style="margin-bottom:0;"><iframe width="100%" height="635" style="border:1px solid #000000;" src="https://cdn.knightlab.com/libs/timeline3/latest/embed/index.html?source=1AQiHJEzkhEi71uIi7wTWWgSFRwR6wRbRyfhbASrw3Ig&font=Default&lang=en&initial_zoom=2&height=650" title="Timeline of Special Pathogens"></iframe></p>
<h2 style="background-color:#c7e5f8;"><span style="font-size:70%;">*Click for <a href="/timeline2access"><button>a screen reader accessible table of this timeline</button></a>. </span></h2>
</div>
Guide
Document providing operation or response information, general guidance documents.
URL
https://ndc.services.cdc.gov/
Objectives
<div class="row match-height">
<div class="col-md-6">
<p>The following links provide surveillance case definitions (a set of uniform criteria used to define a disease for public health surveillance) for current and historical conditions. These links link out to the CDC website.</p>
<h2>A</h2>
<p><a href="https://ndc.services.cdc.gov/conditions/acanthamoeba-disease-excluding-keratitis/"><i>Acanthamoeba</i> disease (excluding keratitis)</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/acanthamoeba-keratitis/"><i>Acanthamoeba</i> keratitis</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/acquired-immunodeficiency-syndrome/">Acquired immunodeficiency syndrome</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/acute-flaccid-myelitis-afm/">Acute Flaccid Myelitis (AFM)</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/acute-flaccid-myelitis-afm/">AFM</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/acquired-immunodeficiency-syndrome/">AIDS</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/hiv-infection-aids-has-been-reclassified-as-hiv-stage-iii/">AIDS/HIV</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/amebiasis/">Amebiasis</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/anaplasma-phagocytophilum-infection/"><i>Anaplasma phagocytophilum</i> infection</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/anthrax/">Anthrax</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/arboviral-diseases-neuroinvasive-and-non-neuroinvasive/">Arboviral diseases, neuroinvasive and non-neuroinvasive</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/arboviral-encephalitis/">Arboviral encephalitis</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/arboviral-encephalitis-or-meningitis/">Arboviral encephalitis or meningitis</a></p>
<h2>B</h2>
<p><a href="https://ndc.services.cdc.gov/conditions/babesiosis/">Babesiosis</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/balamuthia-mandrillaris-disease/"><i>Balamuthia mandrillaris</i> disease</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/blastomycosis/">Blastomycosis</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/botulism/">Botulism</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/botulism-foodborne/">Botulism, foodborne</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/botulism-infant/">Botulism, infant</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/botulism-other/">Botulism, other</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/botulism-wound/">Botulism, wound</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/brucellosis/">Brucellosis</a></p>
<h2>C</h2>
<p><a href="https://ndc.services.cdc.gov/conditions/california-serogroup-encephalitis/">California serogroup encephalitis</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/california-serogroup-encephalitis-meningitis/">California serogroup encephalitis/meningitis</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/california-serogroup-virus-diseases/">California serogroup virus diseases</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/campylobacteriosis/">Campylobacteriosis</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/cancer/">Cancer</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/candida-auris/"><i>Candida auris</i></a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/candida-auris-clinical/"><i>Candida auris</i>, clinical</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/candida-auris-colonization-screening/"><i>Candida auris</i>, colonization/screening</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/candida-auris-screening-surveillance/"><i>Candida auris</i>, screening/surveillance</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/carbapenemase-producing-carbapenem-resistant-enterobacteriaceae-cp-cre/">Carbapenemase Producing Carbapenem-Resistant Enterobacteriaceae (CP-CRE)</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/carbon-monoxide-poisoning/">Carbon monoxide poisoning</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/chancroid/">Chancroid</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/varicella/">Chickenpox</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/chikungunya-virus-disease/">Chikungunya virus disease</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/chlamydia-trachomatis-infection/"><i>Chlamydia trachomatis</i> infection</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/chlamydia-trachomatis-genital-infections/"><i>Chlamydia trachomatis</i>, genital infections</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/cholera/">Cholera</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/coccidioidomycosis/">Coccidioidomycosis</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/congenital-syphilis/">Congenital syphilis</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/coronavirus-disease-2019-covid-19/">Coronavirus Disease 2019 (COVID-19)</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/cp-cre-enterobacter-spp/">CP-CRE, <em>Enterobacter</em> spp.</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/cp-cre-escherichia-coli-e-coli/">CP-CRE, <em>Escherichia coli</em> (<em>E. coli</em>)</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/cp-cre-klebsiella-spp/">CP-CRE, <em>Klebsiella</em> spp.</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/crimean-congo-hemorrhagic-fever-virus/">Crimean-Congo hemorrhagic fever virus</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/rubella-congenital-syndrome/">CRS</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/cryptococcus-gattii-infection/"><i>Cryptococcus gattii</i> infection</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/cryptosporidiosis/">Cryptosporidiosis</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/cyclosporiasis/">Cyclosporiasis</a></p>
<h2>D</h2>
<p><a href="https://ndc.services.cdc.gov/conditions/dengue/">Dengue</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/dengue-fever/">Dengue fever</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/dengue-hemorrhagic-fever/">Dengue hemorrhagic fever</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/dengue-shock-syndrome/">Dengue shock syndrome</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/dengue-virus-infections/">Dengue virus infections</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/dengue-like-illness/">Dengue-like illness</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/dengue-fever/">DF</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/dengue-hemorrhagic-fever/">DHF</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/diphtheria/">Diphtheria</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/streptococcus-pneumoniae-drug-resistant-invasive-disease/">DRSP</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/dengue-shock-syndrome/">DSS</a></p>
<h2>E</h2>
<p><a href="https://ndc.services.cdc.gov/conditions/escherichia-coli-o157h7/"><i>E. coli</i> O157:H7</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/eastern-equine-encephalitis/">Eastern equine encephalitis</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/eastern-equine-encephalitis-virus-disease/">Eastern equine encephalitis virus disease</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/eastern-equine-encephalitis-meningitis/">Eastern equine encephalitis/meningitis</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/ebola-virus/">Ebola virus</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/enterohemorrhagic-escherichia-coli/">EHEC</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/ehrlichia-chaffeensis-infection/"><i>Ehrlichia chaffeensis</i> infection</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/ehrlichia-ewingii-infection/"><i>Ehrlichia ewingii</i> infection</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/ehrlichiosis/">Ehrlichiosis</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/ehrlichiosis-and-anaplasmosis/">Ehrlichiosis and anaplasmosis</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/encephalitis/">Encephalitis</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/encephalitis-arboviral/">Encephalitis, arboviral</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/encephalitis-postinfectious-or-parainfectious/">Encephalitis, postinfectious (or parainfectious)</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/encephalitis-primary/">Encephalitis, primary</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/enterohemorrhagic-escherichia-coli/">Enterohemorrhagic <i>Escherichia coli</i></a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/escherichia-coli-o157h7/"><i>Escherichia coli</i> O157:H7</a></p>
<h2>F</h2>
<p><a href="https://ndc.services.cdc.gov/conditions/foodborne-disease-outbreak/">Foodborne Disease Outbreak</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/free-living-amebae-infections/">Free-living amebae infections</a></p>
<h2>G</h2>
<p><a href="https://ndc.services.cdc.gov/conditions/streptococcus-disease-invasive-group-a/">GAS</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/genital-herpes/">Genital herpes</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/genital-warts/">Genital warts</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/rubella/">German measles</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/giardiasis/">Giardiasis</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/gonorrhea/">Gonorrhea</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/granuloma-inguinale/">Granuloma inguinale</a></p>
<h2>H</h2>
<p><a href="https://ndc.services.cdc.gov/conditions/haemophilus-influenzae-invasive-disease/"><i>Haemophilus influenzae</i>, invasive disease</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/hansens-disease/">Hansen's disease</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/hantavirus-infection-non-hantavirus-pulmonary-syndrome/">Hantavirus infection, non-Hantavirus pulmonary syndrome</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/hantavirus-pulmonary-syndrome/">Hantavirus pulmonary syndrome</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/hemolytic-uremic-syndrome-post-diarrheal/">Hemolytic uremic syndrome, post-diarrheal</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/hepatitis-a-acute/">Hepatitis A, acute</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/hepatitis-b-acute/">Hepatitis B, acute</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/hepatitis-b-chronic/">Hepatitis B, chronic</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/hepatitis-b-perinatal-virus-infection/">Hepatitis B, perinatal virus infection</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/hepatitis-c-acute/">Hepatitis C, acute</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/hepatitis-c-chronic/">Hepatitis C, chronic</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/hepatitis-c-perinatal-infection/">Hepatitis C, Perinatal Infection</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/hepatitis-viral-acute/">Hepatitis, viral, acute</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/human-granulocytic-ehrlichiosis/">HGE</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/histoplasmosis/">Histoplasmosis</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/hiv-infection-aids-has-been-reclassified-as-hiv-stage-iii/">HIV infection (AIDS has been reclassified as HIV Stage III)</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/human-monocytic-ehrlichiosis/">HME</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/hantavirus-pulmonary-syndrome/">HPS</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/human-granulocytic-ehrlichiosis/">Human granulocytic ehrlichiosis</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/human-monocytic-ehrlichiosis/">Human monocytic ehrlichiosis</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/hemolytic-uremic-syndrome-post-diarrheal/">HUS</a></p>
<h2>I</h2>
<p><a href="https://ndc.services.cdc.gov/conditions/influenza-associated-hospitalizations/">Influenza-associated hospitalizations</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/influenza-associated-pediatric-mortality/">Influenza-associated pediatric mortality</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/invasive-pneumococcal-disease/">Invasive pneumococcal disease</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/invasive-pneumococcal-disease/">IPD</a></p>
<h2>K</h2>
<p><a href="https://ndc.services.cdc.gov/conditions/kawasaki-syndrome/">Kawasaki syndrome</a></p>
<h2>L</h2>
<p><a href="https://ndc.services.cdc.gov/conditions/lassa-virus/">Lassa virus</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/latent-tb-infection-tb-infection/">Latent TB Infection (TB Infection)</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/lead-elevated-blood-levels/">Lead, elevated blood levels</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/lead-elevated-blood-levels-adult/">Lead, elevated blood levels, adult (≥16 Years) </a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/lead-elevated-blood-levels-children/">Lead, elevated blood levels, children (<16 Years)</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/legionellosis/">Legionellosis</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/hansens-disease/">Leprosy</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/leptospirosis/">Leptospirosis</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/listeriosis/">Listeriosis</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/lujo-virus/">Lujo virus</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/lyme-disease/">Lyme disease</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/lymphogranuloma-venereum/">Lymphogranuloma venereum</a></p>
</div>
<div class="col-md-6">
<h2>M</h2>
<p><a href="https://ndc.services.cdc.gov/conditions/malaria/">Malaria</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/marburg-virus/">Marburg virus</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/measles/">Measles</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/melioidosis/">Melioidosis</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/meningitis-aseptic/">Meningitis, aseptic</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/meningitis-other-bacterial/">Meningitis, other bacterial</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/meningococcal-disease/">Meningococcal disease</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/mucopurulent-cervicitis/">MPC</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/mucopurulent-cervicitis/">Mucopurulent cervicitis</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/mumps/">Mumps</a></p>
<h2>N</h2>
<p><a href="https://ndc.services.cdc.gov/conditions/naegleria-fowleri-causing-primary-amebic-meningoencephalitis-pam/"><i>Naegleria fowleri</i> causing primary amebic meningoencephalitis (PAM)</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/neurosyphilis/">Neurosyphilis</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/new-world-arenavirus-guanarito-virus/">New World arenavirus – Guanarito virus</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/new-world-arenavirus-junin-virus/">New World arenavirus – Junin virus</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/new-world-arenavirus-machupo-virus/">New World arenavirus – Machupo virus</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/new-world-arenavirus-sabia-virus/">New World arenavirus – Sabia virus</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/nongonococcal-urethritis/">NGU</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/nongonococcal-urethritis/">Nongonococcal urethritis</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/novel-influenza-a-virus-infections/">Novel influenza A virus infections</a></p>
<h2>O</h2>
<p><a href="https://ndc.services.cdc.gov/conditions/psittacosis/">Ornithosis</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/other-or-unspecified-human-ehrlichiosis/">Other or unspecified human ehrlichiosis</a></p>
<h2>P</h2>
<p><a href="https://ndc.services.cdc.gov/conditions/pelvic-inflammatory-disease/">Pelvic inflammatory disease</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/pertussis/">Pertussis</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/pesticide-related-illness-and-injury-acute/">Pesticide-related illness and injury, acute</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/pelvic-inflammatory-disease/">PID</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/plague/">Plague</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/poliomyelitis-paralytic/">Poliomyelitis, paralytic</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/poliovirus-infection-nonparalytic/">Poliovirus infection, nonparalytic</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/powassan-encephalitis-meningitis/">Powassan encephalitis/meningitis</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/powassan-virus-disease/">Powassan virus disease</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/psittacosis/">Psittacosis</a></p>
<h2>Q</h2>
<p><a href="https://ndc.services.cdc.gov/conditions/q-fever/">Q fever</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/q-fever-acute/">Q fever, acute</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/q-fever-chronic/">Q fever, chronic</a></p>
<h2>R</h2>
<p><a href="https://ndc.services.cdc.gov/conditions/rabies-animal/">Rabies, animal</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/rabies-human/">Rabies, human</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/respiratory-syncytial-virus-associated-mortality-rsv-associated-mortality/">Respiratory Syncytial Virus-Associated Mortality (RSV-Associated Mortality)</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/reye-syndrome/">Reye syndrome</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/rheumatic-fever/">Rheumatic fever</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/rocky-mountain-spotted-fever/">RMSF</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/rocky-mountain-spotted-fever/">Rocky Mountain spotted fever</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/rubella/">Rubella</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/rubella-congenital-syndrome/">Rubella, congenital syndrome</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/measles/">Rubeola</a></p>
<h2>S</h2>
<p><a href="https://ndc.services.cdc.gov/conditions/salmonella-paratyphi-infection-salmonella-enterica-serotypes-paratyphi-a-b-tartrate-negative-and-c-s-paratyphi/"><i>Salmonella</i> Paratyphi infection (<i>Salmonella enterica</i> serotypes Paratyphi A, B [tartrate negative], and C [<i>S.</i> Paratyphi])</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/salmonella-typhi-infection-salmonella-enterica-serotype-typhi/"><i>Salmonella</i> Typhi infection (<i>Salmonella enterica</i> serotype Typhi)</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/salmonellosis/">Salmonellosis</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/severe-acute-respiratory-syndrome-associated-coronavirus-disease/">SARS-CoV</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/severe-acute-respiratory-syndrome-associated-coronavirus-disease/">Severe acute respiratory syndrome-associated coronavirus disease</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/severe-dengue/">Severe dengue</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/shiga-toxin-producing-escherichia-coli/">Shiga toxin-producing <i>Escherichia coli</i></a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/shigellosis/">Shigellosis</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/silicosis/">Silicosis</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/smallpox/">Smallpox</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/spinal-cord-injury/">Spinal cord injury</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/spotted-fever-rickettsiosis/">Spotted fever rickettsiosis</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/st-louis-encephalitis/">St. Louis encephalitis</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/st-louis-encephalitis-virus-disease/">St. Louis encephalitis virus disease</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/st-louis-encephalitis-meningitis/">St. Louis encephalitis/meningitis</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/shiga-toxin-producing-escherichia-coli/">STEC</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/streptococcal-toxic-shock-syndrome/">Streptococcal toxic shock syndrome</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/streptococcus-disease-invasive-group-a/">Streptococcus disease, invasive, Group A</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/streptococcus-pneumoniae-drug-resistant-invasive-disease/"><i>Streptococcus pneumoniae</i>, drug-resistant invasive disease</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/invasive-pneumococcal-disease/"><i>Streptococcus pneumoniae</i>, invasive disease</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/streptococcus-pneumoniae-invasive-disease-child/"><i>Streptococcus pneumoniae</i>, invasive disease (child, <5 years)</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/streptococcus-pneumoniae-invasive-disease-non-drug-resistant-child/"><i>Streptococcus pneumoniae</i>, invasive disease non-drug resistant (child, <5 years)</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/streptococcal-toxic-shock-syndrome/">STSS</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/syphilis/">Syphilis</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/syphilis-congenital/">Syphilis, Congenital</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/syphilis-early-latent/">Syphilis, early latent</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/syphilis-early-non-primary-non-secondary/">Syphilis, early non-primary non-secondary</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/syphilis-late-latent/">Syphilis, late latent</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/syphilis-late-with-clinical-manifestations-including-late-benign-syphilis-and-cardiovascular-syphilis/">Syphilis, late with clinical manifestations (including late benign syphilis and cardiovascular syphilis)</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/syphilis-late-with-clinical-manifestations-other-than-neurosyphilis/">Syphilis, late, with clinical manifestations other than neurosyphilis</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/syphilis-latent/">Syphilis, latent</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/syphilis-latent-unknown-duration/">Syphilis, latent unknown duration</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/syphilis-primary/">Syphilis, primary</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/syphilis-secondary/">Syphilis, secondary</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/syphilis-unknown-duration-or-late/">Syphilis, unknown duration or late</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/syphilitic-stillbirth/">Syphilitic stillbirth</a></p>
<h2>T</h2>
<p><a href="https://ndc.services.cdc.gov/conditions/tuberculosis/">TB</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/tetanus/">Tetanus</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/toxic-shock-syndrome-other-than-streptococcal/">Toxic shock syndrome (other than streptococcal)</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/trichinellosis/">Trichinellosis</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/trichinellosis/">Trichinosis</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/toxic-shock-syndrome-other-than-streptococcal/">TSS</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/tuberculosis/">Tuberculosis</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/tularemia/">Tularemia</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/typhoid-fever/">Typhoid fever</a></p>
<h2>U</h2>
<p><a href="https://ndc.services.cdc.gov/conditions/undetermined-human-ehrlichiosis-anaplasmosis/">Undetermined human ehrlichiosis/anaplasmosis</a></p>
<h2>V</h2>
<p><a href="https://ndc.services.cdc.gov/conditions/coccidioidomycosis/">Valley fever</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/vancomycin-intermediate-staphylococcus-aureus-and-vancomycin-resistant-staphylococcus-aureus/">Vancomycin-intermediate <i>Staphylococcus aureus</i> and Vancomycin-resistant <i>Staphylococcus aureus</i></a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/varicella/">Varicella</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/varicella-deaths/">Varicella deaths</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/smallpox/">Variola</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/viral-hemorrhagic-fever/">VHF</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/vibriosis/">Vibriosis</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/viral-hemorrhagic-fever/">Viral hemorrhagic fever</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/meningitis-aseptic/">Viral meningitis</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/vancomycin-intermediate-staphylococcus-aureus-and-vancomycin-resistant-staphylococcus-aureus/">VISA/VRSA</a></p>
<h2>W</h2>
<p><a href="https://ndc.services.cdc.gov/conditions/waterborne-disease-outbreak/">Waterborne Disease Outbreak</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/west-nile-encephalitis-meningitis/">West Nile encephalitis/meningitis</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/west-nile-virus-disease/">West Nile virus disease</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/western-equine-encephalitis/">Western equine encephalitis</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/western-equine-encephalitis-virus-disease/">Western equine encephalitis virus disease</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/western-equine-encephalitis-meningitis/">Western equine encephalitis/meningitis</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/pertussis/">Whooping cough</a></p>
<h2>Y</h2>
<p><a href="https://ndc.services.cdc.gov/conditions/yellow-fever/">Yellow fever</a></p>
<h2>Z</h2>
<p><a href="https://ndc.services.cdc.gov/conditions/zika-virus-disease-and-zika-virus-infection/">Zika virus disease and Zika virus infection</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/zika-virus-disease-congenital/">Zika virus disease, congenital</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/zika-virus-disease-non-congenital/">Zika virus disease, non-congenital</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/zika-virus-infection-congenital/">Zika virus infection, congenital</a></p>
<p><a href="https://ndc.services.cdc.gov/conditions/zika-virus-infection-non-congenital/">Zika virus infection, non-congenital</a></p>
</div>
</div>
Dublin Core
The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.
Title
A name given to the resource
Surveillance Case Definitions for Current and Historical Conditions
Subject
The topic of the resource
Treatment & Care
Description
An account of the resource
<p>A surveillance case definition is a set of uniform criteria used to define a disease for public health surveillance. Surveillance case definitions enable public health officials to classify and count cases consistently across reporting jurisdictions. Surveillance case definitions are not intended to be used by healthcare providers for making a clinical diagnosis or determining how to meet an individual patient’s health needs.</p>
<p>While the list of reportable conditions varies by state, the Council of State and Territorial Epidemiologists (CSTE) has recommended that state health departments report cases of selected diseases to CDC’s National Notifiable Diseases Surveillance System (NNDSS). Every year, case definitions are updated using CSTE’s Position Statements. They provide uniform criteria of national notifiable infectious and non-infectious conditions for reporting purposes.</p>
Creator
An entity primarily responsible for making the resource
CDC
Date
A point or period of time associated with an event in the lifecycle of the resource
2021-04-16
Babesiosis
Candida auris
Case Definition
CDC
Dengue
Ebola
EMS
Flu
Guanarito virus
Identify
Influenza
Lassa
Marburg
Measles
R-T&C
Rubella
Smallpox
-
https://repository.netecweb.org/files/original/42cc1379f3523ef4c23835c9b4049a9b.png
ffa8193d03702a0b82a1a1ca19b763a4
Dublin Core
The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.
Title
A name given to the resource
Discover
Description
An account of the resource
<div style="background-color:#c7e5f8;">
<h2 style="background-color:#c7e5f8;"><span style="font-size:80%;line-height:24px;"><a href="https://repository.netecweb.org/exhibits/show/ncov/ncov"><button>COVID-19 Update</button></a><a href="https://repository.netecweb.org/news#Map"><button>Outbreak Map</button></a><a href="https://repository.netecweb.org/news#News"><button>Newsfeed</button></a><a href="https://repository.netecweb.org/exhibits/show/monkeypox/monkeypox"><button>Monkeypox 2021</button></a><a href="https://repository.netecweb.org/exhibits/show/drcebola2018/drcebola2018"><button>2020 Ebola Update</button></a><a href="https://repository.netecweb.org/ebolatimeline"><button>Ebola Timeline</button></a><a href="https://repository.netecweb.org/exhibits/show/mers/mers"><button>MERS</button></a><a href="https://repository.netecweb.org/exhibits/show/aerosol/aerosol"><button>Airborne Transmission</button></a></span></h2>
<h2 style="background-color:#c7e5f8;">Discover Background Data and Resources:</h2>
<ul><li>
<p><span style="line-height:24px;">Get introduced to NETEC through the interactive timeline of special pathogens below.* This timeline describes some significant special pathogen events in recent history.</span></p>
</li>
<li>
<p><span style="line-height:24px;">Find out more about the 2014 Ebola outbreak and the development of the ASPR/CDC-supported network of healthcare facilities preparing for the next outbreak through <em><a href="/ebolatimeline"><button>the Ebola timeline</button></a>.</em></span></p>
</li>
</ul><ul><li>
<p><span style="line-height:24px;">This NETEC Repository helps to provide training and educational resources to prepare for future special pathogen events. </span></p>
</li>
</ul><ul><li>
<p><span style="line-height:24px;">Explore the files BELOW THE TIMELINE to <em><strong>discover and learn</strong></em> more about Ebola and other Special Pathogens, an overview of special pathogens, clinically managing patients affected, and readying healthcare teams and systems to keep everyone safe.</span></p>
</li>
</ul><h2 style="background-color:#c7e5f8;">Timeline of Special Pathogens:</h2>
<a href="#click">Skip timeline</a>
<p style="margin-bottom:0;"><iframe width="100%" height="635" style="border:1px solid #000000;" src="https://cdn.knightlab.com/libs/timeline3/latest/embed/index.html?source=1AQiHJEzkhEi71uIi7wTWWgSFRwR6wRbRyfhbASrw3Ig&font=Default&lang=en&initial_zoom=2&height=650" title="Timeline of Special Pathogens"></iframe></p>
<h2 style="background-color:#c7e5f8;"><span style="font-size:70%;">*Click for <a href="/timeline2access"><button>a screen reader accessible table of this timeline</button></a>. </span></h2>
</div>
Webinar
Portal access to a webinar
URL
https://emergency.cdc.gov/coca/calls/2017/callinfo_110217.asp
Dublin Core
The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.
Title
A name given to the resource
Ecology of Emerging Zoonotic Diseases
Subject
The topic of the resource
General
Description
An account of the resource
This webinar discusses Nipah virus and Ebola in terms of how human activity increases contact with wildlife and thus zoonotic disease emergence, and discusses interventions that reduce such risk.
Creator
An entity primarily responsible for making the resource
CDC, Office of Public Health Preparedness and Response (CDC OPHPR)
Date
A point or period of time associated with an event in the lifecycle of the resource
2017-11-02
Contributor
An entity responsible for making contributions to the resource
2022-03-17 by Anna Yaffee (Adult Care Group) keep in Resource Library
2023-02-19 by Anna Yaffee T&C group Q1 review
Coverage
The spatial or temporal topic of the resource, the spatial applicability of the resource, or the jurisdiction under which the resource is relevant
2026-02-19
Avian Influenza
Coronavirus
Crimean Congo Haemorrhagic Fever (CCHF)
Ebola
Epidemic
Lassa
Marburg
Nipah (NiV)
Outbreaks
Pandemic
Public Health
R-Gen
Respiratory Pathogen
SARS
Special Pathogens
Viral Hemorrhagic Fever
Zoonotic
-
https://repository.netecweb.org/files/original/902d63dc64839424794cbe3cf08e8f2d.docx
3fa6b794d3d2c46b96b9706e649f9f0d
Dublin Core
The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.
Title
A name given to the resource
Refresher Training Agenda
Dublin Core
The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.
Title
A name given to the resource
Deploy
Description
An account of the resource
<h2><span>These files will help you <strong><em>develop</em></strong> your program and plans based on what you have discovered.</span></h2>
<p style="font-size:120%;">Find model protocols and procedures and more in-depth training resources. You can go to the <a href="/exhibits/show/leadership"><button>Leadership Toolbox</button></a> or the <a href="https://repository.netecweb.org/exhibits/show/specialpopulations"><button>Special Populations</button></a> section. You can also go to the <a href="https://repository.netecweb.org/exhibits/show/netec-education/justintime"><button> Just in Time Training</button></a> page, the <a href="https://repository.netecweb.org/exhibits/show/ppe101/ppe"><button> PPE</button></a> page, or the <a href="https://repository.netecweb.org/exhibits/show/ems/prehospital"><button>EMS</button></a> page. <span>Subscribe to the NETEC <a href="https://www.youtube.com/channel/UCDpHc1LkcEpiWR0q7ll5eZQ" target="_blank" rel="noreferrer noopener"><button>Youtube Channel</button></a> to get all new Skills videos!</span></p>
Exercise
Exercise templates for training and education.
Dublin Core
The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.
Title
A name given to the resource
Refresher Training Agenda
Creator
An entity primarily responsible for making the resource
Emory
Subject
The topic of the resource
Training and Exercises
Description
An account of the resource
Leadership Toolbox, Response: Emory SCDU Refresher Training
Date
A point or period of time associated with an event in the lifecycle of the resource
2018-01-25
Contributor
An entity responsible for making contributions to the resource
2022-03-17 by Anna Yaffee (Adult Care Group) keep in RL SCDU relevant
2023-02-19 by Anna Yaffee T&C group Q1 review
Coverage
The spatial or temporal topic of the resource, the spatial applicability of the resource, or the jurisdiction under which the resource is relevant
2026-02-19
Relation
A related resource
Y - D0.1TE/D0.2TE Qualtrics # 417, original # 304
Y - D0.1TE/D0.2TE Qualtrics # 426, original # 316
Y - D0.1TE/D0.2TE Qualtrics # 428, original # 321
Contact Transmission
Droplet Transmission
Ebola
Lassa
Leadership Toolbox
Marburg
R-T&E
Response Tools
Training
Waste
-
https://repository.netecweb.org/files/original/ff6ba979049bcbac4cf5ed3e100932de.png
4cf17b29ba7b6db239dc5fe3cd70aa33
Dublin Core
The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.
Title
A name given to the resource
Discover
Description
An account of the resource
<div style="background-color:#c7e5f8;">
<h2 style="background-color:#c7e5f8;"><span style="font-size:80%;line-height:24px;"><a href="https://repository.netecweb.org/exhibits/show/ncov/ncov"><button>COVID-19 Update</button></a><a href="https://repository.netecweb.org/news#Map"><button>Outbreak Map</button></a><a href="https://repository.netecweb.org/news#News"><button>Newsfeed</button></a><a href="https://repository.netecweb.org/exhibits/show/monkeypox/monkeypox"><button>Monkeypox 2021</button></a><a href="https://repository.netecweb.org/exhibits/show/drcebola2018/drcebola2018"><button>2020 Ebola Update</button></a><a href="https://repository.netecweb.org/ebolatimeline"><button>Ebola Timeline</button></a><a href="https://repository.netecweb.org/exhibits/show/mers/mers"><button>MERS</button></a><a href="https://repository.netecweb.org/exhibits/show/aerosol/aerosol"><button>Airborne Transmission</button></a></span></h2>
<h2 style="background-color:#c7e5f8;">Discover Background Data and Resources:</h2>
<ul><li>
<p><span style="line-height:24px;">Get introduced to NETEC through the interactive timeline of special pathogens below.* This timeline describes some significant special pathogen events in recent history.</span></p>
</li>
<li>
<p><span style="line-height:24px;">Find out more about the 2014 Ebola outbreak and the development of the ASPR/CDC-supported network of healthcare facilities preparing for the next outbreak through <em><a href="/ebolatimeline"><button>the Ebola timeline</button></a>.</em></span></p>
</li>
</ul><ul><li>
<p><span style="line-height:24px;">This NETEC Repository helps to provide training and educational resources to prepare for future special pathogen events. </span></p>
</li>
</ul><ul><li>
<p><span style="line-height:24px;">Explore the files BELOW THE TIMELINE to <em><strong>discover and learn</strong></em> more about Ebola and other Special Pathogens, an overview of special pathogens, clinically managing patients affected, and readying healthcare teams and systems to keep everyone safe.</span></p>
</li>
</ul><h2 style="background-color:#c7e5f8;">Timeline of Special Pathogens:</h2>
<a href="#click">Skip timeline</a>
<p style="margin-bottom:0;"><iframe width="100%" height="635" style="border:1px solid #000000;" src="https://cdn.knightlab.com/libs/timeline3/latest/embed/index.html?source=1AQiHJEzkhEi71uIi7wTWWgSFRwR6wRbRyfhbASrw3Ig&font=Default&lang=en&initial_zoom=2&height=650" title="Timeline of Special Pathogens"></iframe></p>
<h2 style="background-color:#c7e5f8;"><span style="font-size:70%;">*Click for <a href="/timeline2access"><button>a screen reader accessible table of this timeline</button></a>. </span></h2>
</div>
Publication
A peer reviewed publication.
Citation
Citation information for the publication itself.
Siddle, Katherine J., Philomena Eromon, Kayla G. Barnes, Samar Mehta, Judith U. Oguzie, Ikponmwosa Odia, Stephen F. Schaffner, Sarah M. Winnicki, Rickey R. Shah, James Qu, Shirlee Wohl, Patrick Brehio, Christopher Iruolagbe, John Aiyepada, Eghosa Uyigue, Patience Akhilomen, Grace Okonofua, Simon Ye, Tolulope Kayode, Fehintola Ajogbasile, Jessica Uwanibe, Amy Gaye, Mambu Momoh, Bridget Chak, Dylan Kotliar, Amber Carter, Adrianne Gladden-Young, Catherine A. Freije, Omigie Omoregie, Blessing Osiemi, Ekene B. Muoebonam, Michael Airende, Rachael Enigbe, Benevolence Ebo, Iguosadolo Nosamiefan, Paul Oluniyi, Mahan Nekoui, Ephraim Ogbaini-Emovon, Robert F. Garry, Kristian G. Andersen, Daniel J. Park, Nathan L. Yozwiak, George Akpede, Chikwe Ihekweazu, Oyewale Tomori, Sylvanus Okogbenin, Onikepe A. Folarin, Peter O. Okokhere, Bronwyn L. MacInnis, Pardis C. Sabeti, and Christian T. Happi. 2018. "Genomic Analysis of Lassa Virus during an Increase in Cases in Nigeria in 2018." The New England journal of medicine 379 (18):1745-53.
Abstract
<h2 class="head no_bottom_margin ui-helper-clearfix">Abstract</h2>
<div>
<p id="__p3" class="p p-first-last">In early 2018 Nigeria experienced an unprecedented increase in Lassa fever cases with widespread geographic distribution. We report 77 Lassa virus genomes generated from patient samples, 14 from 2018, to investigate whether recent changes in the virus genome contributed to this surge. Our data argue that the surge is not attributable to a single Lassa virus variant, nor has it been sustained by human-to-human transmission. We observe extensive viral diversity structured by geography, with major rivers appearing to act as barriers to migration of the rodent reservoir. Together our results support that the 2018 Lassa fever surge was driven by crossspecies transmission from local rodent populations of multiple viral variants from different lineages.</p>
</div>
Accessibility
Information on accessibility of the document(s), such as university log-in necessary, request form, open access, etc.
Free online
URL
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6181183/
Read Online
Online location of the resource.
https://www.nejm.org/doi/full/10.1056/NEJMoa1804498
Dublin Core
The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.
Title
A name given to the resource
Genomic Analysis of Lassa Virus during an Increase in Cases in Nigeria in 2018
Subject
The topic of the resource
Research
Description
An account of the resource
In early 2018 Nigeria experienced an unprecedented increase in Lassa fever cases with widespread geographic distribution.
Creator
An entity primarily responsible for making the resource
Katherine J. Siddle, Ph.D., Philomena Eromon, B.Sc., Kayla G. Barnes, Ph.D., Judith U. Oguzie, D.V.M., Samar Mehta, M.D., Ph.D., Ikponmwonsa Odia, M.Sc., Rickey Shah, A.L.M., Patrick Brehio, B.S., Sarah M. Winnicki, M.S., Christopher Iruolagbe, M.B.B.S., John Aiyepada, B.Sc., Eghosa Uyigue, M.Sc., Patience Akhilomen, B.Sc., Grace Okonofua, B.Sc., Bridget Chak, B.A., Dylan Kotliar, B.A., Blessing Osiemi, B.Sc., Ekene Muoebonam, B.Sc., Michael Airende, B.Sc., Rachael Ukpetina, B.Sc., Iguosadolo Nosamiefan, A.B., Paul Oluniyi, M.Sc., Ephraim Ogbaini-Emovon, M.B.B.S., Mahan Nekouin, A.B., Onikepe A. Folarin, Ph.D., Stephen F. Schaffner, Ph.D., Robert F. Garry, Ph.D., Kristian G. Andersen, Ph.D., Daniel J. Park, Ph.D., Nathan L. Yozwiak, Ph.D., Bronwyn L. MacInnis, Ph.D., George Akpede, M.B.B.S., Sylvanus Okogbenin, M.B.B.S., Peter Okokhere, M.B.B.S., Pardis C. Sabeti, M.D., D.Phil., and Christian T. Happi, Ph.D.corresponding author
Date
A point or period of time associated with an event in the lifecycle of the resource
2018-11-01
Type
The nature or genre of the resource
Publication
Epidemiology
Lassa
Outbreaks
R-Res&Pub
Virology
-
Dublin Core
The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.
Title
A name given to the resource
Discover
Description
An account of the resource
<div style="background-color:#c7e5f8;">
<h2 style="background-color:#c7e5f8;"><span style="font-size:80%;line-height:24px;"><a href="https://repository.netecweb.org/exhibits/show/ncov/ncov"><button>COVID-19 Update</button></a><a href="https://repository.netecweb.org/news#Map"><button>Outbreak Map</button></a><a href="https://repository.netecweb.org/news#News"><button>Newsfeed</button></a><a href="https://repository.netecweb.org/exhibits/show/monkeypox/monkeypox"><button>Monkeypox 2021</button></a><a href="https://repository.netecweb.org/exhibits/show/drcebola2018/drcebola2018"><button>2020 Ebola Update</button></a><a href="https://repository.netecweb.org/ebolatimeline"><button>Ebola Timeline</button></a><a href="https://repository.netecweb.org/exhibits/show/mers/mers"><button>MERS</button></a><a href="https://repository.netecweb.org/exhibits/show/aerosol/aerosol"><button>Airborne Transmission</button></a></span></h2>
<h2 style="background-color:#c7e5f8;">Discover Background Data and Resources:</h2>
<ul><li>
<p><span style="line-height:24px;">Get introduced to NETEC through the interactive timeline of special pathogens below.* This timeline describes some significant special pathogen events in recent history.</span></p>
</li>
<li>
<p><span style="line-height:24px;">Find out more about the 2014 Ebola outbreak and the development of the ASPR/CDC-supported network of healthcare facilities preparing for the next outbreak through <em><a href="/ebolatimeline"><button>the Ebola timeline</button></a>.</em></span></p>
</li>
</ul><ul><li>
<p><span style="line-height:24px;">This NETEC Repository helps to provide training and educational resources to prepare for future special pathogen events. </span></p>
</li>
</ul><ul><li>
<p><span style="line-height:24px;">Explore the files BELOW THE TIMELINE to <em><strong>discover and learn</strong></em> more about Ebola and other Special Pathogens, an overview of special pathogens, clinically managing patients affected, and readying healthcare teams and systems to keep everyone safe.</span></p>
</li>
</ul><h2 style="background-color:#c7e5f8;">Timeline of Special Pathogens:</h2>
<a href="#click">Skip timeline</a>
<p style="margin-bottom:0;"><iframe width="100%" height="635" style="border:1px solid #000000;" src="https://cdn.knightlab.com/libs/timeline3/latest/embed/index.html?source=1AQiHJEzkhEi71uIi7wTWWgSFRwR6wRbRyfhbASrw3Ig&font=Default&lang=en&initial_zoom=2&height=650" title="Timeline of Special Pathogens"></iframe></p>
<h2 style="background-color:#c7e5f8;"><span style="font-size:70%;">*Click for <a href="/timeline2access"><button>a screen reader accessible table of this timeline</button></a>. </span></h2>
</div>
Publication
A peer reviewed publication.
Citation
Citation information for the publication itself.
Kraft, Colleen S., Aneesh K. Mehta, Jay B. Varkey, G. Marshall Lyon, Sharon Vanairsdale, Sonia Bell, Eileen M. Burd, Mary Elizabeth Sexton, Leslie Anne Cassidy, Patricia Olinger, Kalpana Rengarajan, Vanessa N. Raabe, Emily Davis, Scott Henderson, Paula DesRoches, Yongxian Xu, Mark J. Mulligan, and Bruce S. Ribner. 2020. "Serosurvey on healthcare personnel caring for patients with Ebola virus disease and Lassa virus in the United States." Infection Control & Hospital Epidemiology 41 (4):385-90.
Abstract
<div class="abstract-content selected">
<p><strong class="sub-title"> Objective: </strong> Healthcare personnel (HCP) were recruited to provide serum samples, which were tested for antibodies against Ebola or Lassa virus to evaluate for asymptomatic seroconversion.</p>
<p><strong class="sub-title"> Setting: </strong> From 2014 to 2016, 4 patients with Ebola virus disease (EVD) and 1 patient with Lassa fever (LF) were treated in the Serious Communicable Diseases Unit (SCDU) at Emory University Hospital. Strict infection control and clinical biosafety practices were implemented to prevent nosocomial transmission of EVD or LF to HCP.</p>
<p><strong class="sub-title"> Participants: </strong> All personnel who entered the SCDU who were required to measure their temperatures and complete a symptom questionnaire twice daily were eligible.</p>
<p><strong class="sub-title"> Results: </strong> No employee developed symptomatic EVD or LF. EVD and LF antibody studies were performed on sera samples from 42 HCP. The 6 participants who had received investigational vaccination with a chimpanzee adenovirus type 3 vectored Ebola glycoprotein vaccine had high antibody titers to Ebola glycoprotein, but none had a response to Ebola nucleoprotein or VP40, or a response to LF antigens.</p>
<p><strong class="sub-title"> Conclusions: </strong> Patients infected with filoviruses and arenaviruses can be managed successfully without causing occupation-related symptomatic or asymptomatic infections. Meticulous attention to infection control and clinical biosafety practices by highly motivated, trained staff is critical to the safe care of patients with an infection from a special pathogen.</p>
</div>
Accessibility
Information on accessibility of the document(s), such as university log-in necessary, request form, open access, etc.
Available online through Cambridge Core.
URL
https://pubmed.ncbi.nlm.nih.gov/32933606/
Read Online
Online location of the resource.
https://www.cambridge.org/core/journals/infection-control-and-hospital-epidemiology/article/serosurvey-on-healthcare-personnel-caring-for-patients-with-ebola-virus-disease-and-lassa-virus-in-the-united-states/1709ACFD0CD63FB92256672CA0B573C2
Dublin Core
The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.
Title
A name given to the resource
Serosurvey on healthcare personnel caring for patients with Ebola virus disease and Lassa virus in the United States
Subject
The topic of the resource
Personnel Management
Description
An account of the resource
Healthcare personnel (HCP) were recruited to provide serum samples, which were tested for antibodies against Ebola or Lassa virus to evaluate for asymptomatic seroconversion.
Creator
An entity primarily responsible for making the resource
Kraft, Colleen S., Aneesh K. Mehta, Jay B. Varkey, G. Marshall Lyon, Sharon Vanairsdale, Sonia Bell, Eileen M. Burd, Mary Elizabeth Sexton, Leslie Anne Cassidy, Patricia Olinger, Kalpana Rengarajan, Vanessa N. Raabe, Emily Davis, Scott Henderson, Paula DesRoches, Yongxian Xu, Mark J. Mulligan, and Bruce S. Ribner.
Date
A point or period of time associated with an event in the lifecycle of the resource
2020-04
Type
The nature or genre of the resource
Publication
Contributor
An entity responsible for making contributions to the resource
2023-07-13 by Christa Arguinchona and Caroline Croyle (PM)
Coverage
The spatial or temporal topic of the resource, the spatial applicability of the resource, or the jurisdiction under which the resource is relevant
2026-07-14
Ebola
Example
Healthcare Worker Monitoring
Laboratory Testing
Lassa
Occupational Exposure
Occupational Health
R-PM
R-Res&Pub
Viral Hemorrhagic Fever
Virology
-
https://repository.netecweb.org/files/original/c1482c7a2d472056626da5720ab66155.pdf
efe615574dc76c57c5c2a366fe0edf41
PDF Text
Text
The Journal of Infectious Diseases
MAJOR ARTICLE
A Case of Human Lassa Virus Infection With Robust
Acute T-Cell Activation and Long-Term Virus-Specific
T-Cell Responses
Anita K. McElroy,1,5 Rama S. Akondy,2 Jessica R. Harmon,5 Ali H. Ellebedy,2 Deborah Cannon,5 John D. Klena,5 John Sidney,6
Alessandro Sette,6 Aneesh K. Mehta,3 Colleen S. Kraft,3,4 Marshall G. Lyon,3 Jay B. Varkey,3 Bruce S. Ribner,3 Stuart T. Nichol,5 and
Christina F. Spiropoulou5
Departments of 1Pediatrics, 2Microbiology and Immunology, 3Medicine, Division of Infectious Disease, and 4Pathology and Laboratory Medicine, Emory University, and 5CDC Viral
Special Pathogens Branch, Atlanta, Georgia, and 6La Jolla Institute for Allergy and Immunology Center for Infectious Disease, California
(See the editorial commentary by Fischer and Wohl on pages 1779–81.)
A nurse who acquired Lassa virus infection in Togo in the spring of 2016 was repatriated to the United States for care at Emory
University Hospital. Serial sampling from this patient permitted the characterization of several aspects of the innate and cellular
immune responses to Lassa virus. Although most of the immune responses correlated with the kinetics of viremia resolution, the
CD8 T-cell response was of surprisingly high magnitude and prolonged duration, implying prolonged presentation of viral antigens.
Indeed, long after viremia resolution, there was persistent viral RNA detected in the semen of the patient, accompanied by epididymitis, suggesting the male reproductive tract as 1 site of antigen persistence. Consistent with the magnitude of acute T-cell responses,
the patient ultimately developed long-term, polyfunctional memory T-cell responses to Lassa virus.
Keywords. Lassa virus; immunology; T cells; biomarkers; human.
Lassa virus is an arenavirus transmitted to humans by inhalation of or exposure to Mastomys natalensis excreta, but it
can also be transmitted person-to-person through virus-infected bodily fluids. The virus is found in West Africa in
areas overlapping with the geography of its animal reservoir.
It is estimated that up to 300 000 cases occur annually with
an overall case fatality ratio of <5%. When symptomatic, the
disease manifests as an acute febrile illness accompanied by
weakness, malaise, retrosternal pain, headache, and gastrointestinal distress [1]. Several more distinctive clinical features
of Lassa virus disease include facial edema, pharyngitis, conjunctivitis, and significant abdominal tenderness [2]. Some
infected individuals are asymptomatic or mildly symptomatic, whereas others experience more severe symptoms. The
impact of genetic polymorphisms or comorbidities on patient
outcome in Lassa virus disease is unknown, but a dysregulated cellular immune response has been hypothesized to
contribute to disease by inducing vascular damage or through
T-cell–mediated immunopathology [3, 4]. Assessment of the
immune response to Lassa virus infection in humans has been
limited by the lack of available resources and infrastructures
in West Africa. Most studies have focused on in vitro assays
of virus growth in human mononuclear phagocytic cells, such
as dendritic cells and macrophages [5–11], and use of nonhuman primates to model human disease [12–18], with only
limited studies of human subjects [19–24].
In spring of 2016, an American nurse working in Togo acquired
Lassa virus infection. The patient was repatriated to the United
States for care at Emory University Hospital. Ribavirin (days 6–15
of illness) and favipirivir (days 8–12 of illness) were administered,
and the patient ultimately survived the infection. The clinical
course has been reported elsewhere (Raabe et al, in press). Serial
blood samples were collected under a research protocol, starting
at day 7 after symptom onset. This provided a rare opportunity to
evaluate the longitudinal course of a primary Lassa virus infection in the human host. A description of the kinetics of this individual’s innate and cellular immune responses is included herein.
MATERIALS AND METHODS
Human Subject Research and Safety
Received 11 January 2017; editorial decision 13 March 2017; accepted 24 April 2017.
Presented in part: Workshop 2B: Clinical and Immunologic Findings During Lassa Infection,
Viral Hemorrhagic Fever Keystone Symposium, Santa Fe, New Mexico, December 2016.
Correspondence: A. McElroy, MD, PhD, US Centers for Disease Control and Prevention, 1600
Clifton Rd, MS G14 Atlanta, GA 30333 (gsz5@cdc.gov).
The Journal of Infectious Diseases® 2017;215:1862–72
Published by Oxford University Press for the Infectious Diseases Society of America 2017.
This work is written by (a) US Government employee(s) and is in the public domain in the US.
DOI: 10.1093/infdis/jix201
1862 • JID 2017:215 (15 June) • McElroy et al
Downloaded from https://academic.oup.com/jid/article-abstract/215/12/1862/3871090
by guest
on 09 February 2018
The patient consented to research under approved human use
protocols at both Emory (IRB00022371) and the US Centers for
Disease Control and Prevention (CDC; IRB6857). Healthy control samples were obtained under CDC IRB1652. The patient
was a previously healthy, 33-year-old male without any underlying immunocompromise or comorbidities. All work with
potentially infectious patient material was performed in CDC’s
�were treated with Cytofix/Cytoperm (BD Biosciences [BD]),
incubated with intracellular antibodies, and then washed
before acquiring events on an Accuri (BD) or a S1000EXi
cytometer (Stratedigm). Compensations were performed
using OneComp beads (eBioscience). See the Supplementary
Methods for list of antibodies used in each stain and for details
of gating strategies.
biosafety level 4 lab. Plasma samples were γ-irradiated with
5 × 106 rads before analysis.
Multiplex Assays
Assays were performed according to manufacturers’ instructions for B-cell activating factor (BAFF), fractalkine, granzyme
B, interferon α (IFN-α), interferon α2 (IFN-α2), interferon β
(IFN-β), interferon γ (IFN-γ), interferon λ (IFN-λ), IFN-γ–
induced protein 10 (IP-10), interleukin 4 (IL-4), interleukin
6 (IL-6), interleukin 8 (IL-8), interleukin 10 (IL-10), interleukin 1 receptor antagonist (IL-1RA), MCP-1, and RANTES
(Affymetrix). If samples had values outside of the standard
curve range, additional dilutions were made to obtain accurate
values for all analytes. Data were collected on a Luminex 200.
In previous work [25], samples from 10 healthy human donors
were analyzed to define the normal range for each analyte.
Antigen-Specific T-Cell Assays
Cryopreserved PBMCs were thawed, rested overnight, and
then incubated for 1 hour at 37°C with concentrated, γ-irradiated virions at a multiplicity of infection of 5, left unstimulated
(negative control), or treated with staphylococcal enterotoxin B
(positive control) at a final concentration of 1 μg/mL. All samples included anti-CD28 and anti-CD49d (diluted 1:1000; BD)
and anti-CD107a PE antibodies. One hour after stimulation,
brefeldin A (10 μg/mL; Sigma-Aldrich) was added, and cells
were incubated for an additional 5 hours. Following experimental and control stimulation, PBMC were stained and acquired as
noted above.
Virus Titer Determination
Serial dilutions of the patient’s plasma were made in Dulbecco’s
modified Eagle’s medium with 5% fetal bovine serum and
placed in replicates of 8 on a 96-well plate of Vero-E6 cells. After
3 days, the cells were fixed in 10% formalin, permeabilized in
0.1% Triton X-100, and stained for Lassa antigen using a CDC
reference serum sample (703116) diluted 1:1000, followed by
antirabbit immunoglobulin G (IgG) 488 (Invitrogen) diluted
1:500 in phosphate-buffered saline (PBS). The method of Reed
and Muench was used to calculate the 50% tissue culture infective dose per milliliter of the virus [26].
Tetramer Assays and Additional Phenotyping
Patient PMBCs were evaluated for HLA-A2 (human leukocyte antigen) expression by flow cytometry using HLA-A2 PE
(BB7.2). Tetramers were then designed based upon the patient’s
HLA-A2–positive status and previously published data on
HLA-A2–specific Lassa virus tetramers [28, 29]. Cryopreserved
PMBCs were thawed, washed, stained with near-infrared live/
dead stain (Life Technologies), and incubated with each tetramer
coupled to either APC or PE before staining and acquisition.
Enzyme-Linked Immunosorbent Assay
Maxisorp plates (Nalgene-Nunc) were coated with Lassa virus
(Togo) lysate prepared from infected Vero-E6 cells as previously
described [27], diluted 1:1000 in PBS, and adsorbed overnight at
4°C. Plates were blocked in 5% milk in PBS with 0.1% Tween-20
(PBST) for 1 hour at 37°C. Plasma samples were serially diluted
in blocking buffer and then incubated on blocked plates for
2 hours at 37°C. After 3 washes in PBST, plates were incubated for 1 hour at 37°C with antihuman IgG HRP (horseradish peroxidase) or antihuman immunoglobulin M (IgM) HRP
(Jackson ImmunoResearch Inc) diluted 1:5000 in blocking
solution. After 3 PBST washes, plates were incubated in TMB
(tetramethylbenzidine) substrate (KPL) for 10 minutes; reactions were stopped with TMB stop solution, and plates were
read at 450 nm.
Data Analysis
All data were analyzed using FlowJo software (TreeStar), Excel
(Microsoft), Prism (GraphPad Software Inc), and SPICE software (open source, National Institute of Allergy and Infectious
Diseases). For determination of Lassa-specific polyfunctionality of the CD4 and CD8 T-cell populations, Boolean gating was
applied, and then background results from unstimulated cells
were subtracted from the signal obtained in Lassa-stimulated
cells. These data were then imported into SPICE for generation
of the plots.
RESULTS
Kinetics of Virus Clearance and Persistence
The patient did not clear viremia until day 20 after symptom
onset (Figure 1) despite having received antiviral therapy from
day 6 onward (Raabe et al, in press). Additionally, the patient’s
semen was qRT-PCR positive on days 15, 20, and 48 and virus
was isolated from a semen sample on day 20 (Raabe et al, in
press). These findings correlated in time with the development
of a self-limiting clinical epididymitis, suggesting that the male
reproductive system could be a site of virus persistence.
Flow Cytometric Analyses
Whole blood (100 μL) was incubated with surface stain antibodies for 20 minutes; then 1× FACS lysis buffer (BD) was
added to each sample, and the cells were washed. For cryopreserved peripheral blood mononuclear cells (PBMCs), cells
were washed in PBS, stained with live/dead stain, then Fc
blocked before surface staining. For intracellular stains, cells
Human Immune Response to Lassa Virus • JID 2017:215 (15 June) • 1863
Downloaded from https://academic.oup.com/jid/article-abstract/215/12/1862/3871090
by guest
on 09 February 2018
�IFN-α
IFN-α2
TCID50 /mL
IFN-γ
3
2
5
4
3
0
2
1
Log pg/mL
6
1
Log pg/mL
7
IFN-α
Log pg/mL
2
IFN-β
3
8
Log TCID50/mL
Log pg/mL
3
2
1
1
2
0
20
40
60
0
1
0
20
40
IFN-λ
0
20
0
20
2
1
40
60
Day after symptom onset
IL-8
2
Log pg/mL
Log pg/mL
0
60
IL-10
3
3
40
Day after symptom onset
IP-10
4
Log pg/mL
0
60
Day after symptom onset
Day after symptom onset
2
Log pg/mL
-1
1
1
0
2
0
20
40
60
0
20
Day after symptom onset
40
IL-6
IL-1 RA
1
3
2
40
60
0
0
20
Day after symptom onset
BAFF
40
60
1
0
20
Log pg/mL
Log pg/mL
1
40
1
0
60
0
1
20
40
60
Day after symptom onset
RANTES
Fractalkine
2
60
2
Day after symptom onset
2
40
IL-4
2
-1
3
3
20
3
Day after symptom onset
4
0
Day after symptom onset
0
1
20
.
60
MCP-1
Log pg/mL
Log pg/mL
Log pg/mL
2
40
3
4
0
20
Day after symptom onset
5
3
Log pg/mL
0
Day after symptom onset
4
0
60
0
Log pg/mL
0
-1
Granzyme B
5
4
4
3
Log pg/mL
1
3
2
1
2
0
0
0
20
40
60
0
Day after symptom onset
20
40
60
Day after symptom onsetet
1
0
20
40
Day after symptom onset
60
0
0
20
40
60
Day after symptom onset
Figure 1. Kinetic analysis of various immune markers. Patient plasma was analyzed by multiplex assay for the indicated immune markers over time. The dotted line represents the limit of detection of the assay, and the shaded area represents the range of detection in 10 healthy humans. In the first panel, viral load kinetics were overlaid
for comparison, and the hash-marked line represents the limit of detection of the viral load assay. Abbreviations: BAFF, B-cell activating factor; IFN-α, interferon α; IFN-α2,
interferon α2; IFN-β, interferon β; IFN-γ, interferon γ; IFN- λ, interferon λ; IL-4, interleukin 4; IL-6, interleukin 6; IL-8, interleukin 8; IL-10, interleukin 10; IL-1RA, interleukin 1
receptor antagonist; IP-10, interferon γ–induced protein 10; TCID50, 50% tissue culture infective dose.
Interferon, Cytokine and Chemokine Responses
Antigen-presenting cells are an important initial target of Lassa
virus infection in vivo [14], and Lassa virus infection of macrophages and dendritic cells in vitro results in inhibition of
type I interferon (IFN) responses through viral nucleoprotein
[7]. In nonhuman primate models, early and limited induction
of type 1 IFN was associated with survival [18]. Therefore, it
was of interest to measure the IFN responses in this patient.
In fact, an early peak of IFN-α, but not IFN-α2 or IFN-β, was
1864 • JID 2017:215 (15 June) • McElroy et al
Downloaded from https://academic.oup.com/jid/article-abstract/215/12/1862/3871090
by guest
on 09 February 2018
noted (Figure 1). Only at day 7 after symptom onset was IFN-γ
detectable, and IFN-λ was at the high end of the normal range
throughout the time course. The kinetics of IFN-α in this patient
correlated (r = 0.9947) with viral load.
Chemokines or cytokines that recruit or modulate cellular
functions could also be of importance during Lassa virus infection. In 1 previous study, higher levels of IL-8 and IP-10 were
associated with survival from Lassa virus infection [20]; however, in a contrasting study, higher levels of IL-8, IL-6, IL-10, and
�MIP-1β were associated with fatal Lassa virus infection [24]. In
this patient, levels of IP-10 and IL-10 were detected at a log or
more above that observed in normal healthy controls, but only
sporadic, low levels of IL-8 and IL-6 were observed (Figure 1). In
1 other report, both IL-8 and IL-6 were notably elevated in a nonfatal case [23]. Other immune modulators that were elevated in
the patient included IL-1RA, which can have antagonistic activity
similar to IL-10, and MCP-1, which is both a chemoattractant
for macrophages and an activator of endothelial cells (Figure 1).
Interleukin 4 and BAFF, which play a role in B-cell activation
and class switching, were elevated in the patient, and their peak
coincided with viremia resolution (Figure 1). Finally, CX3CL1
(fractalkine) and RANTES, which are T-cell chemoattractants,
were both elevated in this patient. Early in disease, plasma levels
of granzyme B, a T-cell effector, were detected, suggesting early
activation of cytotoxic cellular pathways.
A
10
Log
TCID50 /mL
108
6
IgG
107
5
IgM
106
4
105
3
104
2
103
1
102
0
0
10
20
30
40
50
60
TCID50/mL
endpoint titer
7
101
Day after symptom onset
B
Healthy donor
Patient
CD20
Robust Activation of B and T Cells During the Acute Stage
Virus clearance from the blood correlated with the appearance
of Lassa virus–specific IgM, but the appearance of Lassa virus–
specific IgG was delayed, with no IgG detectable until almost
20 days after onset of symptoms (Figure 2A). This late appearance of class-switched antibodies is described in the Lassa virus
literature [27, 30], although earlier class switching has also
been reported. Antibody-secreting cells (ASCs, also known as
plasmablasts), peaked on day 19 after symptom onset. This was
followed closely in time by a peak in the activated B-cell population; this is the population of B cells that are destined to become
long-lived memory B cells (Figure 2B) [31].
The patient’s T-cell responses were robust, with an activated
CD4 T-cell population, defined by CD38/HLADR doublepositive cells, peaking at day 19 after symptom onset and
subsequently declining (Figure 3A). In contrast, the patient’s
activated CD8 T-cell population exhibited a biphasic pattern,
with an early peak that kinetically matched viral clearance, and
another peak on day 23 after symptom onset. This second peak
was sustained well beyond a month after symptom onset. The
activation phenotype coincided with proliferation and functional effector molecule production because the Ki-67–positive
frequency was similar to the CD38/HLA-DR–double-positive
frequency (Figure 3B), and the Ki-67–positive cells expressed
both perforin and granzyme B (Figure 3C). Further phenotyping of these proliferating cells revealed them to have low BCL-2
and CD45RA levels and high PD-1 levels, consistent with an
effector phenotype (Figure 3D). This second peak of activation
and effector differentiation coincided with lymphadenopathy
and epididymitis in the patient (Raabe et al, in press).
CD71
% ABC or ASC
100
ABC
ASC
80
60
40
20
0
0
50
100
150
Day after symptom onset
Figure 2. Class switching corresponds with peak frequency of antibody-secreting
cells. A, Patient samples were analyzed by enzyme-linked immunosorbent assay for
Lassa virus–specific immunoglobulin M and immunoglobulin G responses, and viral
loads were determined by 50% tissue culture infective dose assay. The hash-marked
line represents the limit of detection of the viral load assay. B, Representative
flow plots for both antibody-secreting cells (ASCs; CD3− CD14− CD16− IgD− CD19+
CD20loCD71+) and activated B cells (ABCs; CD3 − CD14− CD16− IgD− CD19+ CD20++
CD71+) are depicted for both the patient (at day 23) and a healthy control, and
frequencies of ASCs and ABCs were assessed over time. Abbreviations: ABC,
activated B cell; ASC, antibody-secreting cell; IgG, immunoglobulin G; IgM, immunoglobulin M; TCID50, 50% tissue culture infective dose.
HLA-A2 binding epitopes in Lassa virus GP using predictive
algorithms, in vitro binding assays, and in vivo analysis in HLAA2–transgenic mice [28, 29]. This permitted the evaluation of
Lassa virus–specific T cells over the course of the infection
Phenotypic Characterization of Lassa-Specific CD8 T Cells Using
MHC-class I Tetramers
The patient was identified as HLA-A2–positive by flow
cytometry, and previous work by others had evaluated several
Human Immune Response to Lassa Virus • JID 2017:215 (15 June) • 1865
Downloaded from https://academic.oup.com/jid/article-abstract/215/12/1862/3871090
by guest
on 09 February 2018
�Patient
B
Control
Activated CD8 T cells Day 23
1.6
CD38
81.3
Activated CD4 T cells Day 19
% Ki-67
% 38/HLA-DR
100
% Positive CD8 T Cells
A
80
60
40
20
0
0
20
40
60
Day after symptom onset
35.1
3.9
D23 CD8+ cells
C
Patient
Control
Ki-67
100
108
CD8
CD4
TCID50 /mL
80
107
106
60
105
40
104
103
20
Perforin
D
D12 CD8+ cells
Granzyme B
D16 CD8+ cells
D30 CD8+ cells
102
0
20
40
60
101
Day after symptom onset
Ki-67
0
TCID50/mL
% CD38/HLA-DR –posiitve T cells
HLA-DR
BCL-2
CD45RA
PD-1
Figure 3. T-cell activation was prolonged and had an effector phenotype. A, Representative flow plots of activated CD8 (top) and CD4 (bottom) T cells are depicted for both
the patient and a healthy control, and frequencies of CD38+/HLA-DR+ CD8 and CD4 T cells were assayed over time. The viral load is also overlaid for comparison. The hashmarked line represents the limit of detection of the viral load assay. B, The frequency of CD38/HLA-DR double-positive CD8 T cells as compared with the frequency of Ki-67+
CD8 T cells. Representative flow plots showing the functionality (C) of the K-67+ CD8 T cells and their phenotype (D). Abbreviation: TCID50, 50% tissue culture infective dose.
and allowed for characterization of these cells. Three peptides
were selected from those previously identified based on the
glycoprotein sequence of the reference Lassa virus strain
(Josiah). One additional peptide was selected based on the
predicted IC50 binding to MHC HLA-A*02:01 (IEDB.org)
using the glycoprotein sequence of the Togo strain (Gen Bank
accession no. KU961971), with which the patient was infected.
Supplementary Table 1 summarizes the peptides used, their
sequences in both the Josiah and Togo strains, and the predicted
and tested HLA-A*02:01 binding affinities (IC50 nM) [32] of the
Togo strain–based peptides. Tetramers were generated for all
4 peptides and analyzed over time in the patient samples. The
patient had tetramer-positive CD8 T cells for 3 of the 4 tested
tetramers (Figure 4A). Tetramer-positive T cells were present at
very low frequency on day 10, but increased by 20 and 30 days
after symptom onset before declining again in convalescence
(data not shown). Tetramer YLI had the highest frequency
overall and was maintained at the time of convalescence.
Phenotyping YLI-positive CD8 T cells during the acute phase
demonstrated that they were CD45RA–low, consistent with an
1866 • JID 2017:215 (15 June) • McElroy et al
Downloaded from https://academic.oup.com/jid/article-abstract/215/12/1862/3871090
by guest
on 09 February 2018
effector phenotype; they were also Ki-67–positive and PD-1–
high, with a subpopulation also expressing CD28 (Figure 4B).
In general, this mirrored the phenotyping of the total CD8
T-cell populations over time, with the majority of the CD8 T
cells being of effector phenotype (CCR7/CD45RA–doublenegative) at the first time point (day 10) with both high PD-1
and Ki-67 expression (Figure 5). As the infection resolved and
virus was cleared at day 20, CD28 and PD-1 expression on CD8
T cells increased, and finally, at the point of convalescence,
decreased Ki-67 expression, increased CD28 expression,
and decreased PD-1 expression were noted, consistent with
a decrease in the massive CD8 T-cell activation seen earlier.
Interestingly, we observed that the acute stage was associated
with <2% of CD45RA+CCR7+ CD8 T cells. Although there was
some increase of this population during the convalescent stage
(approximately 6%), it was much lower than what is reported
for similarly aged healthy adults (20%–60%) [33], suggesting an
altered distribution of naive CD8 T cells or their recruitment
(Figure 5). Very little expression of perforin was observed at any
of the time points.
�Tetramer-PE
A
GII
LLG
0.44
YLI
0.22
SLL
0.07
0.81
Day 20
Tetramer-APC
B
0.4
92.3
91.8
0.9
69.5
23.6
Day 10
0.4
6.8
0.8
87.1
7.3
0
87.1
0.2
5.9
25.3
0.9
63.5
Ki-67
Day 20
0.6
11.5
12.4
0.2
8.6
1.5
37.9
38.6
0.2
17.8
2.6
22.5
Day 30
3.2
57.4
0.2
2.8
60.1
1.1
2.8
0
52.6
7.1
2.1
0.9
Day 129
15.2
81.8
PD-1
90.0
7.2
CD45RA
86.7
10.3
CD28
Figure 4. Tetramer-specific CD8 T cells are of the effector phenotype. A, Tetramers GII, LLG, YLI, and SLL were generated based upon HLA-A2 predicted peptides from the
Lassa virus GPC protein, and the frequency of tetramer-specific CD8 T cells at day 20 is shown. B, Additional phenotyping of the highest frequency tetramer, YLI, over time.
Tetramer-positive cells are depicted in red. Abbreviations: APC, allophycocyanin; PE, phycoerythrin.
(Figure 6A). Whereas the magnitude of the Lassa-specific
CD4 T-cell response declined at the convalescent time point,
the polyfunctional nature of the response was maintained
(Figure 6B).
In contrast with the CD4 T-cell data, the CD8 T-cell responses
took longer to become polyfunctional and exhibited the greatest magnitude of IFN-γ, TNF-α, and CD107a expression at the
convalescent time point (Figure 7). The Lassa virus–specific
CD8 T-cell responses at the convalescent time point were dominated by polyfunctional cells, with approximately 75% of the
Lassa virus–specific CD8 T cells expressing >1 cytokine upon
stimulation (Figure 7B). There were no Lassa-specific CD4 or
CD8 T-cell responses observed in a normal healthy control
(Supplementary Figure 1).
Lassa-Specific T-Cell Function
To assess the functional activity of the patient’s T cells over
time, cryopreserved PMBCs obtained from the patient during
the acute stage of illness were evaluated in an ex vivo stimulation assay along with a convalescent sample from 4 months
after symptom onset. Surprisingly, even in the unstimulated
control samples, we observed tumor necrosis factor α (TNF-α)
elaboration from CD4 T cells (Figure 6A) in acute-phase samples, as well as degranulation from CD8 T cells, as measured by
CD107a (Figure 7A).
In the CD4 T-cell compartment, exposure to Lassa virus ex
vivo led to increased expression of IFN-γ and TNF-α, as well
as IL-2 and CD154, with the highest levels of both single and
double producers seen at 20 and 30 days after symptom onset
Human Immune Response to Lassa Virus • JID 2017:215 (15 June) • 1867
Downloaded from https://academic.oup.com/jid/article-abstract/215/12/1862/3871090
by guest
on 09 February 2018
�Day 20
Day 30
Day 129
PD-1
Day 10
CCR7
CD28
Ki-67
CD45RA
Perforin
Figure 5. Total CD8 T-cell phenotyping reveals a predominance of effector-type cells during the acute phase. CD8 T cells were analyzed for expression of PD-1, CD28, CCR7,
CD45RA, Ki-67, and perforin using flow cytometry at different time points to characterize the phenotypes of the total CD8 T-cell population during infection.
DISCUSSION
In this study, we report a detailed analysis of the primary
human immune response to infection with Lassa virus. There
are several limitations to this study: sampling did not begin
until 7 days after symptom onset, data from only 1 patient were
analyzed, and only the bloodstream was sampled. During the
earliest time point, when the most significant declines in viral
load were observed, the antigen-specific cells were likely localized to the affected tissues rather than in the bloodstream, thus
limiting our ability to quantify them. However, given the paucity of this type of human data, these findings shed light on the
magnitude and quality of the human immune response during
primary Lassa virus infection.
The patient in this study survived Lassa virus infection and
exhibited control over viral replication as evidenced by virus
clearance at day 20 after onset of symptoms. The kinetics of the
patient’s immune responses suggests that multiple components
of the immune response could have played a role in viral clearance. Several cytokine/chemokine responses coincided with
1868 • JID 2017:215 (15 June) • McElroy et al
Downloaded from https://academic.oup.com/jid/article-abstract/215/12/1862/3871090
by guest
on 09 February 2018
viral clearance, and both Lassa virus–specific IgM and activated
CD8 T-cell levels were increasing at the time of maximal decline
in viral load. It was interesting to note that the patient had high
levels of IFN-α during the time of viral decline and that the
IFN-α levels over time correlated with this decline. Whether this
reflects a proportional response to the amounts of viral RNA
present or represents a direct effect of IFN-α’s antiviral activities
is unknown. However, an early and strong IFN-α response in a
macaque model of Lassa virus disease correlated with survival
[18]; IFN-α and IFN-β, but not IFN-λ or IFN-γ, inhibited viral
replication in infected macrophages and dendritic cells in vitro
[6]; and Lassa virus persisted in IFNR−/− mice but was rapidly
cleared from wild-type mice [34]. Together, these data imply
that the INF-α response seen in this patient could have directly
affected virus clearance and may represent a clinically relevant
prognostic marker.
The other inflammatory markers that were examined also
mirrored viral load kinetics, with the notable exception of
IL1-RA and IL-10. Both of these immunomodulatory cytokines
�A
Ne g at ive
Las s a
Negative
Lassa
Ne g at ive
Las s a
Day 10
IFN-γ
Day 20
Day 30
Day 129
TNF-α
CD154
IL-2
B
Pie chart arc
CD154 +
IFN- γ +
TNF- α +
IL-2 +
CD4 T cells
Day 10
CD154
IFN-γ
TNF-α
IL-2
Pie slice
Day 20
+
+
+
+
+
+
+
+
+
+
+
+
Day 30
+
+
+
+
+
+
Day 129
+
+
+
+
+
+
+
+
+
+
+
+
+
+
Figure 6. Greatest magnitude of Lassa virus–specific CD4 T-cell function was observed during the acute phase of infection. A, Ex vivo stimulation followed by flow cytometry was used to examine cytokine expression from CD4 T cells upon stimulation with viral antigen. B, SPICE plots were generated to demonstrate the fraction of Lassa-specific
cells that were producing each cytokine in response to antigen stimulation at each time point. Pie wedge colors refer to the legend below, whereas pie arc colors refer to the
legend to the right. Abbreviations: IFN-γ, interferon γ; IL-2, interleukin 2; TNF-α, tumor necrosis factor α.
ASCs. Levels of the B cell–activating cytokines IL-4 and BAFF
also peaked during this transition and declined thereafter. Both
IL-4 and IL-10 are known to stimulate B cells to class switch
to IgG1 [35]. These data suggest a coordination of the humoral
were elevated initially, declined, and then peaked again just after
day 20 after symptom onset. The second peak correlated with
the peak of Lassa virus–specific IgM, the appearance of Lassa
virus-specific IgG, and the highest frequency of class-switched
Human Immune Response to Lassa Virus • JID 2017:215 (15 June) • 1869
Downloaded from https://academic.oup.com/jid/article-abstract/215/12/1862/3871090
by guest
on 09 February 2018
�A
Negative
Lassa
Negative
Lassa
Negative
Lassa
Day 10
IFN-γ
Day 20
Day 30
Day 129
TNF-α
CD107a
IL-2
B
Pie chart arc
CD107a +
IFN- γ +
TNF- α +
IL-2 +
CD8 T cells
Day 10
CD107a
IFN-γ
TNF-α
IL-2
Pie slice
Day 20
+
+
+
+
+
+
+
+
+
+
+
+
Day 30
+
+
+
+
+
+
+
Day 129
+
+
+
+
+
+
+
+
+
+
+
+
+
Figure 7. Greatest degree of Lassa virus–specific CD8 T-cell polyfunctionality was observed in convalescence. A, Ex vivo stimulation followed by flow cytometry was used
to examine cytokine expression from CD8 T cells upon stimulation with viral antigen. B, SPICE plots were generated to demonstrate the fraction of Lassa-specific cells that
were producing each immune marker in response to antigen stimulation at each time point. Pie wedge colors refer to the legend below, whereas pie arc colors refer to the
legend to the right. Abbreviations: IFN-γ, interferon γ; IL-2, interleukin 2; TNF-α, tumor necrosis factor α.
response and subsequent transition of that response from acute
toward memory once class switching has occurred. Indeed, in
2 other studies of Lassa fever patients, the same association
between IgM and IgG appearance and IL-10 was noted [21, 23].
1870 • JID 2017:215 (15 June) • McElroy et al
Downloaded from https://academic.oup.com/jid/article-abstract/215/12/1862/3871090
by guest
on 09 February 2018
The kinetics of an IgM increase coinciding with a viral load
decrease might suggest that the IgM response played a role in
viral clearance. It has been proposed that the anti-Lassa antibody response does little to control the infection and resolve
�involve larger numbers of patients to allow for a better understanding of which aspects of the host response determine survival and which might contribute to disease progression.
disease because neutralizing antibodies are rarely detected in
the acute phase [36], high neutralizing antibody titers were
required for protection in passive transfer experiments [37,
38], and antibody responses in vaccinated rhesus monkeys did
not correlate with protection [39]. However, other antibodymediated functions (eg, antibody-dependent complement fixation) could have played a role in virus clearance in the patient.
Previous studies of Lassa virus in animal models have
demonstrated that the host T-cell response contributes to
virus clearance at early phases of infection but that it can also
contribute to immune-mediated pathology later in the infection
[3, 4, 18]. In the patient described herein, a second phase of CD8
T-cell activation was noted during the third week of illness. At
this same time point, the CD8 T cells exhibited their highest
levels of spontaneous degranulation (CD107a expression in
the absence of stimulation). This coincided with the clinical
development of diffuse lymphadenitis, epididymitis, and chills,
all in the absence of detectable viremia (Raabe et al, in press).
This finding suggests both persistence of viral antigen, resulting
in sustained activation of CD8 T cells, and a possible immunemediated etiology of the clinical symptoms. Additionally, this
patient had detectable viral RNA in semen long after resolution
of all clinical symptoms, implicating the male reproductive
system as a reservoir of antigen, similar to what has been
observed with Ebola virus [40–43].
The Lassa virus–specific CD4 T-cell activity peaked on day
20, coincident with the peak of activated CD4 T cells; however, the activity of Lassa virus–specific CD8 T cells was highest during convalescence. These findings, combined with the
overall decreased Staphylococcus enterotoxin B responses that
were observed in the CD8 T cells during the acute phase relative to the convalescent phase (Supplementary Figure 2), imply
that Lassa virus infection causes diminished T-cell function
largely in the CD8 T-cell population during acute infection
despite coexpression of high markers of activation. A similar
phenomenon was observed when the lymphocytes of Lassa
virus–infected macaques were treated ex vivo with phytohemagglutinin and pokeweed mitogen [12] and has been suggested
to also occur during Ebola virus infection of humans [44].
In summary, a coordinated immune response consisting
of early and robust IFN-α expression, coupled with the presence of large numbers of activated CD8 T cells, correlated with
virus clearance. In spite of some degree of immune dysfunction
during the acute phase, the patient was ultimately able to generate long-term, polyfunctional, Lassa virus–specific T cells, with
approximately 66% of the CD4 T cells and 75% of the CD8 T
cells expressing >1 cytokine. Although the effects of the antiviral
treatments that this patient received (favipiravir and ribavirin)
could have contributed to the rate of viral load decline or might
have altered the observed immune responses, this example of a
successful human immune response to Lassa virus infection can
serve as a model for future studies. Ideally, future work would
Supplementary Data
Supplementary materials are available at The Journal of Infectious Diseases
online. Consisting of data provided by the authors to benefit the reader, the
posted materials are not copyedited and are the sole responsibility of the
authors, so questions or comments should be addressed to the corresponding author.
Notes
Acknowledgments. The authors would like to thank the patient for
agreeing to participate in the research, the Emory Serious Communicable
Diseases Unit team for providing excellent clinical care and for sample
collection, Sri Edupuganti and the Emory Hope Clinic for assistance with
institutional review board approvals, and Tatanya Klimova for review of the
manuscript. The authors would like to thank Rafi Ahmed for reviewing the
data and his valuable suggestions on how to improve the manuscript.
Disclaimer. The views expressed in this article are those of the authors
and do not represent the official position of the US CDC.
Financial support. This work was performed while Anita K. McElroy
held a Burroughs Wellcome Career Award for Medical Scientists and an
NIH K08 (AI119448-02) and while Alessandro Sette held a National
Institutes of Health contract (HHSN27220140045C).
Potential conflicts of interest. All authors: No reported conflicts of
interest. All authors have submitted the ICMJE Form for Disclosure of
Potential Conflicts of Interest. Conflicts that the editors consider relevant to
the content of the manuscript have been disclosed.
References
1. McCormick JB, King IJ, Webb PA, et al. A case–control study of the clinical diagnosis and course of Lassa fever. J Infect Dis 1987; 155:445–55.
2. McCormick JB. Clinical, epidemiologic, and therapeutic aspects of Lassa fever.
Med Microbiol Immunol 1986; 175:153–5.
3. Flatz L, Rieger T, Merkler D, et al. T cell–dependence of Lassa fever pathogenesis.
PLoS Pathog 2010; 6:e1000836.
4. Oestereich L, Lüdtke A, Ruibal P, et al. Chimeric mice with competent hematopoietic immunity reproduce key features of severe Lassa fever. PLoS Pathog 2016;
12:e1005656.
5. Baize S, Kaplon J, Faure C, Pannetier D, Georges-Courbot MC, Deubel V. Lassa
virus infection of human dendritic cells and macrophages is productive but fails to
activate cells. J Immunol 2004; 172:2861–9.
6. Baize S, Pannetier D, Faure C, et al. Role of interferons in the control of Lassa virus
replication in human dendritic cells and macrophages. Microbes Infect 2006;
8:1194–202.
7. Carnec X, Baize S, Reynard S, et al. Lassa virus nucleoprotein mutants generated
by reverse genetics induce a robust type I interferon response in human dendritic
cells and macrophages. J Virol 2011; 85:12093–7.
8. Mahanty S, Hutchinson K, Agarwal S, McRae M, Rollin PE, Pulendran B. Cutting
edge: impairment of dendritic cells and adaptive immunity by Ebola and Lassa
viruses. J Immunol 2003; 170:2797–801.
9. Pannetier D, Reynard S, Russier M, et al. Human dendritic cells infected with the
nonpathogenic Mopeia virus induce stronger T-cell responses than those infected
with Lassa virus. J Virol 2011; 85:8293–306.
10. Lukashevich IS, Maryankova R, Vladyko AS, et al. Lassa and Mopeia virus replication in human monocytes/macrophages and in endothelial cells: different effects
on IL-8 and TNF-alpha gene expression. J Med Virol 1999; 59:552–60.
11. Russier M, Reynard S, Tordo N, Baize S. NK cells are strongly activated by Lassa
and Mopeia virus–infected human macrophages in vitro but do not mediate virus
suppression. Eur J Immunol 2012; 42:1822–32.
12. Fisher-Hoch SP, Mitchell SW, Sasso DR, Lange JV, Ramsey R, McCormick JB.
Physiological and immunologic disturbances associated with shock in a primate
model of Lassa fever. J Infect Dis 1987; 155:465–74.
13. Zapata JC, Salvato MS. Genomic profiling of host responses to Lassa virus: therapeutic potential from primate to man. Future Virol 2015; 10:233–56.
14. Hensley LE, Smith MA, Geisbert JB, et al. Pathogenesis of Lassa fever in cynomolgus macaques. Virol J 2011; 8:205.
Human Immune Response to Lassa Virus • JID 2017:215 (15 June) • 1871
Downloaded from https://academic.oup.com/jid/article-abstract/215/12/1862/3871090
by guest
on 09 February 2018
� 15. Callis RT, Jahrling PB, DePaoli A. Pathology of Lassa virus infection in the rhesus
monkey. Am J Trop Med Hyg 1982; 31:1038–45.
16. Jahrling PB, Hesse RA, Eddy GA, Johnson KM, Callis RT, Stephen EL. Lassa virus
infection of rhesus monkeys: pathogenesis and treatment with ribavirin. J Infect
Dis 1980; 141:580–9.
17. Walker DH, Johnson KM, Lange JV, Gardner JJ, Kiley MP, McCormick JB.
Experimental infection of rhesus monkeys with Lassa virus and a closely related
arenavirus, Mozambique virus. J Infect Dis 1982; 146:360–8.
18. Baize S, Marianneau P, Loth P, et al. Early and strong immune responses are associated with control of viral replication and recovery in Lassa virus–infected cynomolgus monkeys. J Virol 2009; 83:5890–903.
19. ter Meulen J, Badusche M, Kuhnt K, et al. Characterization of human CD4(+)
T-cell clones recognizing conserved and variable epitopes of the Lassa virus nucleoprotein. J Virol 2000; 74:2186–92.
20. Mahanty S, Bausch DG, Thomas RL, et al. Low levels of interleukin-8 and interferon-inducible protein-10 in serum are associated with fatal infections in acute
Lassa fever. J Infect Dis 2001; 183:1713–21.
21. Schmitz H, Köhler B, Laue T, et al. Monitoring of clinical and laboratory data in
two cases of imported Lassa fever. Microbes Infect 2002; 4:43–50.
22. Meulen Jt, Badusche M, Satoguina J, et al. Old and new world arenaviruses share a
highly conserved epitope in the fusion domain of the glycoprotein 2, which is recognized by Lassa virus-specific human CD4+ T-cell clones. Virology 2004; 321:134–43.
23. Grove JN, Branco LM, Boisen ML, et al. Capacity building permitting comprehensive monitoring of a severe case of Lassa hemorrhagic fever in Sierra Leone with a
positive outcome: case report. Virol J 2011; 8:314.
24. Branco LM, Grove JN, Boisen ML, et al. Emerging trends in Lassa fever: redefining
the role of immunoglobulin M and inflammation in diagnosing acute infection.
Virol J 2011; 8:478.
25. McElroy AK, Harmon JR, Flietstra TD, et al. Kinetic analysis of biomarkers in a
cohort of US patients with Ebola virus disease. Clin Infect Dis 2016; 63:460–7.
26. Reed LJ, Muench H. A simple method of estimating fifty per cent endpoints. Am J
Epidemiol 1938; 27:493–7.
27. Bausch DG, Rollin PE, Demby AH, et al. Diagnosis and clinical virology of Lassa
fever as evaluated by enzyme-linked immunosorbent assay, indirect fluorescent-antibody test, and virus isolation. J Clin Microbiol 2000; 38:2670–7.
28. Botten J, Alexander J, Pasquetto V, et al. Identification of protective Lassa virus
epitopes that are restricted by HLA-A2. J Virol 2006; 80:8351–61.
29. Boesen A, Sundar K, Coico R. Lassa fever virus peptides predicted by computational analysis induce epitope-specific cytotoxic-T-lymphocyte responses in HLAA2.1 transgenic mice. Clin Diagn Lab Immunol 2005; 12:1223–30.
1872 • JID 2017:215 (15 June) • McElroy et al
Downloaded from https://academic.oup.com/jid/article-abstract/215/12/1862/3871090
by guest
on 09 February 2018
30. Wulff H, Johnson KM. Immunoglobulin M and G responses measured by immunofluorescence in patients with Lassa or Marburg virus infections. Bull World
Health Organ 1979; 57:631–5.
31. Ellebedy AH, Jackson KJ, Kissick HT, et al. Defining antigen-specific plasmablast
and memory B cell subsets in human blood after viral infection or vaccination. Nat
Immunol 2016; 17:1226–34.
32. Sidney J, Southwood S, Moore C, et al. Measurement of MHC/peptide interactions
by gel filtration or monoclonal antibody capture. Curr Protoc Immunol 2013;
100:18.3.1–36.
33. Hong MS, Dan JM, Choi JY, Kang I. Age-associated changes in the frequency of
naïve, memory and effector CD8+ T cells. Mech Ageing Dev 2004; 125:615–8.
34. Yun NE, Poussard AL, Seregin AV, et al. Functional interferon system is required
for clearance of lassa virus. J Virol 2012; 86:3389–92.
35. Malisan F, Brière F, Bridon JM, et al. Interleukin-10 induces immunoglobulin G
isotype switch recombination in human CD40-activated naive B lymphocytes. J
Exp Med 1996; 183:937–47.
36. Jahrling PB, Frame JD, Rhoderick JB, Monson MH. Endemic Lassa fever in
Liberia. IV. Selection of optimally effective plasma for treatment by passive immunization. Trans R Soc Trop Med Hyg 1985; 79:380–4.
37. Jahrling PB. Protection of Lassa virus-infected guinea pigs with Lassa-immune
plasma of guinea pig, primate, and human origin. J Med Virol 1983; 12:93–102.
38. Jahrling PB, Peters CJ, Stephen EL. Enhanced treatment of Lassa fever by immune
plasma combined with ribavirin in cynomolgus monkeys. J Infect Dis 1984;
149:420–7.
39. McCormick JB, Mitchell SW, Kiley MP, Ruo S, Fisher-Hoch SP. Inactivated Lassa
virus elicits a non protective immune response in rhesus monkeys. J Med Virol
1992; 37:1–7.
40. Deen GF, Knust B, Broutet N, et al. Ebola RNA persistence in semen of Ebola virus
disease survivors—preliminary report. N Engl J Med 2015; p. 151014140118009.
doi: 10.1056/NEJMoa1511410.
41. Fischer RJ, Judson S, Miazgowicz K, Bushmaker T, Munster VJ. Ebola virus persistence in semen ex vivo. Emerg Infect Dis 2016; 22:289–91.
42. Sow MS, Etard JF, Baize S, et al.; Postebogui Study Group. New evidence of
long-lasting persistence of Ebola virus genetic material in semen of survivors. J
Infect Dis 2016; 214:1475–6.
43. Uyeki TM, Erickson BR, Brown S, et al. Ebola virus persistence in semen of male
survivors. Clin Infect Dis 2016; 62:1552–5.
44. Agrati C, Castilletti C, Casetti R, et al. Longitudinal characterization of dysfunctional T cell-activation during human acute Ebola infection. Cell Death Dis 2016;
7:e2164.
�
Dublin Core
The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.
Title
A name given to the resource
A Case of Human Lassa Virus Infection With Robust Acute T-Cell Activation and Long-Term Virus-Specific T-Cell Responses
Dublin Core
The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.
Title
A name given to the resource
Develop
Description
An account of the resource
<h2><span>These files will help you <strong><em>develop</em></strong> your program and plans based on what you have discovered.</span></h2>
<p style="font-size:120%;">Find model protocols and procedures and more in-depth training resources. You can go to the <a href="/exhibits/show/leadership"><button>Leadership Toolbox</button></a> or the <a href="https://repository.netecweb.org/exhibits/show/specialpopulations"><button>Special Populations</button></a> section. You can also go to the <a href="https://repository.netecweb.org/exhibits/show/netec-education/justintime"><button> Just in Time Training</button></a> page, the <a href="https://repository.netecweb.org/exhibits/show/ppe101/ppe"><button> PPE</button></a> page, or the <a href="https://repository.netecweb.org/exhibits/show/ems/prehospital"><button>EMS</button></a> page. <span>Subscribe to the NETEC <a href="https://www.youtube.com/channel/UCDpHc1LkcEpiWR0q7ll5eZQ" target="_blank" rel="noreferrer noopener"><button>Youtube Channel</button></a> to get all new Skills videos!</span></p>
Publication
A peer reviewed publication.
URL
https://www.ncbi.nlm.nih.gov/pubmed/28863472
Read Online
Online location of the resource.
https://academic.oup.com/jid/article/215/12/1862/3871090
Citation
Citation information for the publication itself.
McElroy, A. K., R. S. Akondy, J. R. Harmon, A. H. Ellebedy, D. Cannon, J. D. Klena, J. Sidney, A. Sette, A. K. Mehta, C. S. Kraft, M. G. Lyon, J. B. Varkey, B. S. Ribner, S. T. Nichol and C. F. Spiropoulou (2017). "A Case of Human Lassa Virus Infection With Robust Acute T-Cell Activation and Long-Term Virus-Specific T-Cell Responses." J Infect Dis 215(12): 1862-1872.
Abstract
A nurse who acquired Lassa virus infection in Togo in the spring of 2016 was repatriated to the United States for care at Emory University Hospital. Serial sampling from this patient permitted the characterization of several aspects of the innate and cellular immune responses to Lassa virus. Although most of the immune responses correlated with the kinetics of viremia resolution, the CD8 T-cell response was of surprisingly high magnitude and prolonged duration, implying prolonged presentation of viral antigens. Indeed, long after viremia resolution, there was persistent viral RNA detected in the semen of the patient, accompanied by epididymitis, suggesting the male reproductive tract as 1 site of antigen persistence. Consistent with the magnitude of acute T-cell responses, the patient ultimately developed long-term, polyfunctional memory T-cell responses to Lassa virus.
Accessibility
Information on accessibility of the document(s), such as university log-in necessary, request form, open access, etc.
free online - Oxford Academic
Dublin Core
The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.
Title
A name given to the resource
A Case of Human Lassa Virus Infection With Robust Acute T-Cell Activation and Long-Term Virus-Specific T-Cell Responses
Creator
An entity primarily responsible for making the resource
McElroy, A. K., R. S. Akondy, J. R. Harmon, A. H. Ellebedy, D. Cannon, J. D. Klena, J. Sidney, A. Sette, A. K. Mehta, C. S. Kraft, M. G. Lyon, J. B. Varkey, B. S. Ribner, S. T. Nichol and C. F. Spiropoulou
Subject
The topic of the resource
Research
Description
An account of the resource
A nurse who acquired Lassa virus infection in Togo in the spring of 2016 was repatriated to the United States for care at Emory University Hospital.
Date
A point or period of time associated with an event in the lifecycle of the resource
2017-06-15
Type
The nature or genre of the resource
Publication
Antibodies
Immunology
Lassa
Patient Care
R-Res&Pub
Therapeutics
-
https://repository.netecweb.org/files/original/e695b5debec4f1546c709cdfffe10a57.png
eae536d830e34c10b6ee0ad685635e7a
https://repository.netecweb.org/files/original/472f336ffe6cfa62a3dd483be26f50c1.pdf
ce51d3de59841ffd0b3f29a9cd913d0b
PDF Text
Text
NETEC Webinar Series:
Identify, Isolate, and Inform The I’s Have It!
�Content Outline (TOC)
Welcome
Shelly Schwedhelm, MSN, RN, NEA-BC
�Overview
Welcome: Shelly Schwedhelm, MSN, RN, NEA-BC
Background on Identify, Isolate, and Inform: Kate Boulter, BAN, RN, MPH
Current Landscape of Lassa Fever
and Exposures in ED Department: James V. Lawler, MD, MPH, FIDSA
Identify, Isolate, and Inform Explained: Kate Boulter, BAN, RN, MPH
Importance of Identify, Isolate, and Inform
During a Pandemic: James V. Lawler, MD, MPH, FIDSA
Questions and Answers with NETEC
NETEC Resources: Shelly Schwedhelm, MSN, RN, NEA-BC
�NETEC Mission
NETEC sets and advances the gold standard for
special pathogen preparedness and response across
health care delivery systems with the goals of driving
best practices, closing knowledge gaps, and
developing innovative resources.
For more information
Please visit us at www.netec.org
or email us at info@netec.org
�Areas of Focus
Consultation
Education
Research Network
Deliver didactic and handson simulation training via
Build
Meet Fred
Empower hospitals to gauge
their readiness using
Self-Assessment
In-Person Courses
Measure facility and healthcare
worker readiness using
Central IRB Process
for rapid implementation of
clinical research protocols
Provide self-paced education through
Online Trainings
Metrics
Provide direct feedback to hospitals via
On-Site Assessment
Compile
Online Repository
Provide
of tools and resources
Develop Policies,
Procedures and Data
Capture Tools
to facilitate research
On-Site and Remote Guidance
Provide
Emergency On-Call
Mobilization
Develop customizable
Exercise Templates
based on the HSEEP model
Cross-Cutting, Supportive Activities
Create infrastructure for a
Specimen
Biorepository
�Content Outline (TOC)
Background on Identify, Isolate, and Inform
Kate Boulter, BAN, RN, MPH
�Background on Identify, Isolate, and Inform
Developed as a tool to aid the
recognition of patients with risk factors
for having Ebola Virus Disease
Modifying the process allows us to
recognize other infectious diseasesr i.e.,
COVID-19, Lassa Fever
Knowing what the current risks are is
important
Link to CDC Graphic
Early identification
Is KEY to taking the steps to prevent the spread of
disease and increase safety for staff and others
�Content Outline (TOC)
Current Landscape of Lassa Fever and
Exposures in the ED Department
James Lawler, MD, MPH, FIDSA
�Current Landscape of Lassa Fever: United Kingdom 2022
Early Jan: Patient admitted to hospital in
southeast England with syndrome of fever,
fatigue, malaise, and diarrhea. Recently
returned from a trip to Mali. Recovers and
discharged.
Household contact in late term pregnancy
develops febrile illness. No travel hx.
Delivers in hospital. Newborn becomes ill
r
Lassa fever diagnostic testing returns
positive on Feb 8.
Death of newborn announced on Feb 11.
Mother recovers.
Dozens of healthcare workers from two
hospitals quarantined.
https://news.sky.com/story/lassa-fever-uk-detects-two-cases-of-ebola-like-virus-that-can-cause-vaginal-bleeding-and-deafness-12537596
�Current Landscape of Lassa Fever
and Exposures in the ED Department
What is Lassa Fever?
Acute, often severe, febrile illness caused by
Lassa virus (LASV)
LASV is member of the family Arenaviridae
(arenaviruses)
“sandy”
Reservoirs and vectors are small rodents
Relative of the South American hemorrhagic fever
viruses
Common endemic disease of West Africa
From Burki. Lancet. Volume 391, Issue 10122, 24 February–2 March 2018, Page 728 https://doi.org/10.1016/S0140-6736(18)30432-X
�Endemic and Hyper-Endemic Areas for Lassa Fever
r
https://www.cdc.gov/vhf/lassa/outbreaks/index.html
Fichet-Calvet and Rogers. PLoS NTD 2009. https://doi.org/10.1371/journal.pntd.0000388
�Lassa Fever Vector and Seasonality
r
Figure 1. Trend of Lassa fever confirmed cases in Nigeria from 2016 to 2020 by 53
epidemiological weeks (retrieved from NCDC Lassa Fever Situation Report, 2020)17.
Multimammate rat (Mastomys)
https://www.journalijtdh.com/index.php/IJTDH/article/view/20027
John-Ugwuanya A. Grace, PhD, Ifunanya J. Egoh, MSc, and Nnenna Udensi, MSc
Ther Adv Infect Dis. 2021 Jan-Dec; 8: 20499361211058252.
Published online 2021 Nov 29. doi: 10.1177/20499361211058252
�Current Landscape of Lassa Fever
and Exposures in the ED Department
Burden of Lassa Fever in West Africa
100,000-500,000 estimated cases per year in West Africa
5,000 annual deaths
Estimated overall CFR 1-2%
CFR for recognized cases 15-40%
In hyperendemic areas of Sierra Leone and Liberia, 10-15% of cases
acute febrile illness cases admitted to hospital are Lassa
Sources
•
•
•
•
https://africacdc.org/disease/lassa-fever/
Trans R Soc Trop Med Hyg 2014; 108: 126–132 doi:10.1093/trstmh/tru009
Inf Dis Clin N Amer 2019; 30(4):933 https://doi.org/10.1016/j.idc.2019.08.002
https://www.cdc.gov/vhf/lassa/index.html
�Lassa Fever: Transmission
r
Nosocomial transmission of Lassa fever is well
documented
Generally, occurs in hospital settings with limited
resources and poor adherence to good infection
prevention and control (IPC) practices
https://www.afro.who.int/news/frontlines-fight-against-lassa-fever-nigeria
�Lassa Fever: Clinical Presentation
Incubation period up to 21 days
Most cases (80%) likely mild or asymptomatic
More severe disease starts as systemic febrile illness
• Fever, malaise, body aches, headache, GI symptoms, sore
throat, conjunctivitis
• Can progress to involve facial swelling, bruising/bleeding,
neurologic deficits
Common lab features – low platelets, proteinuria, elevated liver
enzymes
r
CFR for hospitalized disease roughly 1 in 3
• Higher for pregnant women
Large proportion of survivors (25%) experience hearing deficit
Sources
https://africacdc.org/disease/lassa-fever/
Trans R Soc Trop Med Hyg 2014; 108: 126–132 doi:10.1093/trstmh/tru009
Inf Dis Clin N Amer 2019; 30(4):933 https://doi.org/10.1016/j.idc.2019.08.002
https://www.cdc.gov/vhf/lassa/index.html
Lassa Fever. In Emerging Infectious Disease Clinical Case Studies. Amsterdam Elsevier. 2014.
https://www.sciencedirect.com/science/article/pii/B9780124169753000042
https://www.sciencedirect.com/science/
article/pii/B9780124169753000042
�Current Landscape of Lassa Fever
and Exposures in the ED Department
Lassa Fever: Diagnosis and Treatment
Lassa diagnosis requires laboratory with
experience in Lassa diagnostics
Generally, use serology to detect IgM and
IgG antibodies
PCR becoming more available
Genetic diversity of LASV makes universal
Lassa tests less reliable – assays specific
for geographic region work better
In US, diagnostic specimens generally
sent to CDC for testing
Intravenous ribavirin is recommended
treatment in West Africa
• Difficult to obtain
• Expensive (>5,000 Euro/course)
Oral ribavirin is used as substitute if
no IV available
Oral ribavirin can be used for PEP
• NOT a benign drug
Efficacy of ribavirin against LASV is
debated
�Content Outline (TOC)
Identify, Isolate, and Inform
Kate Boulter, BAN, RN, MPH
�IDENTIFY
r
�Identify: Early Recognition is KEY
Do They Look Sick?
Visual cues of a potentially
infectious person
Facial cues:
•
•
•
•
Puffy face
Droopy eyes
Dark eyes
Red nose
Body language: • Posture
Skin:
• Pale/ flushed
• Diaphoretic
https://royalsocietypublishing.org/doi/10.1098/rspb.2017.2430
�Identify: Early Recognition is KEY
If a Patient Looks Sick…..
Take steps to protect yourself and others
Put on PPE
Give the patient a mask
Prepare for what’s next
�Identify: Screening
“ I just ran 5 miles to
get here because my
wife was admitted in
labor”
What are we going to ask?
Do you have any signs of infection?
Have you traveled lately?
Symptoms associated with Lassa Fever
can be non-specific
and much like other illnesses or conditions
“I returned from Nigeria
last week where I came
in contact with
rodents.”
�Identify: Screening
What we need to know
Case definition: a set of uniform criteria
that defines a disease
Clinical Criteria
• Signs
• Symptoms
Epidemiological Risk Factors
• Travel (within known incubation period)
• Exposure
�Identify: Considerations Where We Need to be Prepared
Know the Points of Entry at Your Facility
Walk-ins
Potential Points of Entry
•
•
•
Emergency department
Clinics
Ambulatory care centers
By Ambulance
• Preidentified as a PUI
• Identified en route as a PUI
• May not be identified as a
PUI until arrival
•
•
Arrive by themselves
Brought in by another person(s)
Patient Condition
• Non-Emergent
• Emergent
• Critical
• Expired
�Identify: Self Screening
Screening: Signage
Signage enables patients to self-identify
Signage needs to be:
• Positioned prominently and easily seen
• Easily understood, with simple to
follow directions
• Written in languages representative
of the community
• Created with pictograms that are
easy to follow
�ISOLATE
r
�Isolate: Be Prepared to Respond Quickly
Have a plan, and know how you will
transfer the patient
Prepare a cart with everything you will need
including a resource binder
r
Remove all extra equipment from the room
Have a plan for getting equipment
you many need
Know how you will manage waste
Keep a record of staff who enter the room
�Isolate
What Should Go in the Resource Binder?
Resource/Reference binder
• Current SOPs
• Current PPE checklists
• Room setup
• Log sheet for isolation room ”in & out”
• Stakeholders to be notified
• Supply lists
• Locations of supplies
�Isolate
Plan for Communication
ü Patient to family
ü Provider to provider
ü Provider to patient
�Isolate
Know What Staff Will be Involved
Direct care providers?
•
•
•
•
Nursing
MD
Consulting MD
Respiratory Therapist
Indirect care providers
•
•
•
•
•
Dietary
Administrators
Pharmacists
EVS
Laboratorians
�INFORM
r
�Inform
Communication: Internal and External
It helps to put communications in two buckets, internal and external
• Lists help to ensure you notify all the right people
• Your Institution may dictate who gets called first
or in what order
• The III algorithm should have information on who
is to be notified and when and by who
NOTIFYING OTHERS WILL ACTIVATE RESOURCES!
�Inform
Internal Communication
People you may want to have on your list?
-
Charge RN
ED (or place where pt is located) MD
Infectious Disease
Infection Prevention/Epidemiology
ED (or place where pt is located) leadership
Staffing
Safety
Security
Environmental Services
Supply chain
Emergency Management
Laboratory
Public relations team
Administration
�Inform
External Communication
Who should you call externally?
People you want to make sure are on your list:
• Public health (local/state)
• EMS/transport
• Specialty services not available at your facility
• For example, pediatrics, labor & delivery, etc.
• Other resources specific to your institution, region or CONOPS plan?
• CDC
Know who makes those phone calls?
Details are important. Be accurate and relay needed information
�Portion of Screening Algorithm Example
r
�Identify, Isolate, and Inform
Practice, Practice, and More Practice
Communication Drills
Mystery Patient Drills
�Content Outline (TOC)
The Importance of Identify, Isolate, and Inform
During a Pandemic
James Lawler, MD, MPH, FIDSA
�Lessons from Luton
High-consequence infectious diseases
can pop up anywhere
• Not just urban centers
High index of suspicion is required
r
Family members, care-givers,
healthcare workers, and those who
prepare remains for burial are at
highest risk for secondary transmission
Ebola is not the only viral hemorrhagic
fever transmissible from person to person
�r
https://www.who.int/emergencies/disease-outbreak-news/item/lassa-fever---nigeria
�r
https://www.eurosurveillance.org/content/10.2807/1560-7917.ES.2017.22.39.17-00088
�r
�r
https://www.sciencedirect.com/science/article/pii/S187962571300062X
�Questions
and
Answers
�Content Outline (TOC)
NETEC Resources
Shelly Schwedhelm, MSN, RN, NEA-BC
�NETEC Resources
NETEC is Here to Help
NETEC will continue to build resources, develop online education,
and deliver technical training to meet the needs of our partners
Ask for help!
Send questions to info@netec.org - they will be answered by NETEC SMEs
Submit a Technical Assistance request at NETEC.org
�Contact
NETEC eLearning Center
NETEC Podcasts
NETEC Skill videos
courses.netec.org
“Transmission Interrupted”
youtube.com/thenetec
(On all major podcast players)
Join the Conversation!
@theNETEC
@the_NETEC
Use hashtag: #NETEC
Website
Resource Library
Email
netec.org
repository.netecweb.org
info@netec.org
��
Dublin Core
The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.
Title
A name given to the resource
Deploy
Description
An account of the resource
<h2><span>These files will help you <strong><em>develop</em></strong> your program and plans based on what you have discovered.</span></h2>
<p style="font-size:120%;">Find model protocols and procedures and more in-depth training resources. You can go to the <a href="/exhibits/show/leadership"><button>Leadership Toolbox</button></a> or the <a href="https://repository.netecweb.org/exhibits/show/specialpopulations"><button>Special Populations</button></a> section. You can also go to the <a href="https://repository.netecweb.org/exhibits/show/netec-education/justintime"><button> Just in Time Training</button></a> page, the <a href="https://repository.netecweb.org/exhibits/show/ppe101/ppe"><button> PPE</button></a> page, or the <a href="https://repository.netecweb.org/exhibits/show/ems/prehospital"><button>EMS</button></a> page. <span>Subscribe to the NETEC <a href="https://www.youtube.com/channel/UCDpHc1LkcEpiWR0q7ll5eZQ" target="_blank" rel="noreferrer noopener"><button>Youtube Channel</button></a> to get all new Skills videos!</span></p>
Webinar
Portal access to a webinar
Duration
Length of time involved (seconds, minutes, hours, days, class periods, etc.)
Webinar: Apr 1, 2022 12:00 PM in Central Time (US and Canada)<br /><br />Online Course: The estimated time to complete this enduring material is 60 minutes.
Objectives
<p><strong>TARGET AUDIENCE</strong></p>
<p>This accredited continuing education activity is intended primarily for healthcare workers and teams which may include but are not limited to, medical and nursing staff, administration, education/training leadership, and infection control leadership. Staff specializing in emergency management, communications, specialized clinical areas, laboratory, facilities management and environmental services are also welcome.</p>
<p><strong>EDUCATIONAL OBJECTIVES </strong></p>
<p>At the conclusion of this enduring material, the participant should be better able to:</p>
<ul>
<li>Recognize the importance of early recognition of potentially infectious individuals</li>
<li>Describe steps to reduce exposure to others and the environment</li>
<li class="Default" style="font-size:12pt;font-family:'Univers LT Std 45 Light', sans-serif;">Organize a notification system applicable to home institution and public health system</li>
</ul>
<p><strong>REQUIREMENTS FOR SUCCESSFUL COMPLETION</strong></p>
<p>In order to receive continuing education credit, you must complete these steps prior to the activity expiration date.</p>
<ol>
<li>View the entire presentation</li>
<li>Complete the post-test with a score of 2 out of 3 or better</li>
<li>Complete the online evaluation</li>
<li>Submit the Completion Attestation</li>
</ol>
<br /><strong>CONTINUING EDUCATION</strong><br /><br />CNE and CME continuing education credits will be provided for this activity. Participants will be asked to complete an evaluation immediately following the webinar. We recommend accessing the webinar from a PC or Mac computer using the Chrome, Firefox, or Safari (Mac) web browser.<br /><br />1 CEU (CNE, CME) is available for this activity.<br /><br />For more information, contact NETEC at info@netec.org.
Event Type
Webinar, watch at link below.
URL
https://youtu.be/QkGflp7W7Cc
Player
Field for the html for a video player.
<br /><iframe width="560" height="315" src="https://www.youtube.com/embed/QkGflp7W7Cc" title="YouTube video player" frameborder="0"></iframe>
Alternate URL
Other URLs if necessary.
CEU online course: <a href="https://courses.netec.org/courses/identify-isolate-inform-the-is-have-it" target="_blank" title="Online Course Link" rel="noreferrer noopener">https://courses.netec.org/courses/identify-isolate-inform-the-is-have-it</a>
Dublin Core
The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.
Title
A name given to the resource
NETEC COVID-19 Webinar Series (4/1/22)/Online Course: Identify, Isolate, Inform. The I's have it.
Subject
The topic of the resource
Infection Control
Description
An account of the resource
Identify, Isolate, Inform - The I's Have It!<br /><br />NETEC webinar presentation: Identify, Isolate, Inform. The I's Have It. Topics will include the importance of early recognition in identifying individuals potentially infected with a special pathogen, steps that can be taken to reduce special pathogen exposure to others and the environment, and tips on organizing a notification system applicable to both a home institution and the public health system.<br /><br /><br />PRESENTERS<br /><br />Kate Boulter, BAN (HONS), MPH, RN<br />Nurse Manager Nebraska Biocontainment Unit<br />Nebraska Medicine | University of Nebraska Medical Center, Omaha, Nebraska<br /><br />Dr. James Lawler, MD, MPH, FIDSA<br />Associate Professor, Department of Internal Medicine<br />Director, International Programs and Innovation, Global Center for Health Security<br />Director, Clinical and Biodefense Research<br />Nebraska Medicine | University of Nebraska Medical Center, Omaha, Nebraska<br /><br />Trish Tennill, RN, BSN<br />Associative Director of Nursing<br />Health and Hospitals Bellevue New York, New York<br /><br />Webinar slides attached.<br /><br /><br />
<h2><br />Get educational credit for this webinar through <a href="https://courses.netec.org/courses/identify-isolate-inform-the-is-have-it" target="_blank" title="CEU link" rel="noreferrer noopener">Courses.netec.org</a>.</h2>
Creator
An entity primarily responsible for making the resource
NETEC
Date
A point or period of time associated with an event in the lifecycle of the resource
2022-04-01
Relation
A related resource
Y - D0.1IIT/D0.2IIT Qualtrics # 704
Y - D0.1IIT/D0.2IIT Qualtrics # 705
Y - D0.1IIT/D0.2IIT Qualtrics # 707
Y - D0.1IIT/D0.2IIT Qualtrics # 716
Type
The nature or genre of the resource
Webinar and Online Course
Contributor
An entity responsible for making contributions to the resource
2024-03-27 IIT - haven't gotten back first review - bump to next quarter
Coverage
The spatial or temporal topic of the resource, the spatial applicability of the resource, or the jurisdiction under which the resource is relevant
2024-06-27
CEU
CEUs
CME
CNE
Identify
Infection Prevention and Control
Isolate
Lassa
Online Course
R-IIT
-
https://repository.netecweb.org/files/original/2095b71cc39b27027d11cd8ee5bbc8ca.pdf
7b437da3f0db25dba09509da74b7526c
PDF Text
Text
Laboratory Resources:
Lassa Fever
ABOUT LASSA FEVER:
Lassa fever is an animal-borne, or zoonotic, acute viral illness. It is endemic in parts of West
Africa, including Sierra Leone, Liberia, Guinea, and Nigeria. Neighboring countries are also at
risk, as the animal vector for Lassa fever virus (LASV), the “multimammate rat” (Mastomys
natalensis), is distributed throughout the region. Transmission of Lassa virus to humans occurs
most commonly through ingestion or inhalation of rodent excretions. Person-to-person
transmission may occur after exposure to the virus in the blood, tissue, secretions, or excretions
of a Lassa virus-infected individual.
CDC INFORMATION ON LASSA FEVER
CLICK HERE
DIAGNOSTIC TESTING:
Currently, testing for LASV is performed by the Centers for Disease Control and Prevention (CDC).
CDC PAGE ON SPECIMEN TYPE AND SUBMISSION
CLICK HERE
The CDC must be contacted, and approval is required prior to sending specimens.
Expedited turnaround times may be discussed at the time of inquiry.
CDC COMPLETE LABORATORY TEST MENU
CLICK HERE
PACKAGING AND SHIPPING:
For more information on packaging a Category A specimen.
INFORMATION ON PACKAGING CATEGORY A SPECIMEN'S PDF
CLICK HERE
Note: All individuals who ship Category A specimens
≈ must be trained and certified.
Check your institution for training opportunities.
TRAINING ON PACKAGING & SHIPPING DANGEROUS GOODS
CLICK HERE
NETEC Collection Checklist for Collection & Transport of Specimens Containing
Special Pathogens.
INFORMATION ON COLLECTION & PACKAGING SPECIMENS PDF
CLICK HERE
MANAGING AND TESTING ROUTINE CLINICAL SPECIMENS:
Clinical specimens that have the potential to contain Lassa fever virus should be handled
in a manner similar to other viral hemorrhagic fever specimens.
CDC GUIDANCE FOR MANAGING & TESTING POTENTIAL EVD SPECIMENS (APPLICABLE TO ALL VHFs)
5.19.2022
CLICK HERE
�
Dublin Core
The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.
Title
A name given to the resource
Develop
Description
An account of the resource
<h2><span>These files will help you <strong><em>develop</em></strong> your program and plans based on what you have discovered.</span></h2>
<p style="font-size:120%;">Find model protocols and procedures and more in-depth training resources. You can go to the <a href="/exhibits/show/leadership"><button>Leadership Toolbox</button></a> or the <a href="https://repository.netecweb.org/exhibits/show/specialpopulations"><button>Special Populations</button></a> section. You can also go to the <a href="https://repository.netecweb.org/exhibits/show/netec-education/justintime"><button> Just in Time Training</button></a> page, the <a href="https://repository.netecweb.org/exhibits/show/ppe101/ppe"><button> PPE</button></a> page, or the <a href="https://repository.netecweb.org/exhibits/show/ems/prehospital"><button>EMS</button></a> page. <span>Subscribe to the NETEC <a href="https://www.youtube.com/channel/UCDpHc1LkcEpiWR0q7ll5eZQ" target="_blank" rel="noreferrer noopener"><button>Youtube Channel</button></a> to get all new Skills videos!</span></p>
Guide
Document providing operation or response information, general guidance documents.
Dublin Core
The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.
Title
A name given to the resource
Laboratory Resources: Lassa Fever
Subject
The topic of the resource
Laboratory
Description
An account of the resource
This guide, printable flyer, provides laboratory resources related to Lassa Fever. This is a part of a series of one-page resource guides for laboratorians.
Creator
An entity primarily responsible for making the resource
NETEC
Date
A point or period of time associated with an event in the lifecycle of the resource
2022-05-17
Coverage
The spatial or temporal topic of the resource, the spatial applicability of the resource, or the jurisdiction under which the resource is relevant
2025-05-17
Contributor
An entity responsible for making contributions to the resource
2022-09-27 - general asset review - Treatment & Care group
Lab
Laboratorian
Laboratory
Laboratory Testing
Lassa
One Page Flyer
One-pager
R-Lab
Viral Hemorrhagic Fever
-
https://repository.netecweb.org/files/original/0273c7748f58fd289bd729f7927f9e89.png
07a6c38b053cb68867c3624a96ccf222
Dublin Core
The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.
Title
A name given to the resource
Discover
Description
An account of the resource
<div style="background-color:#c7e5f8;">
<h2 style="background-color:#c7e5f8;"><span style="font-size:80%;line-height:24px;"><a href="https://repository.netecweb.org/exhibits/show/ncov/ncov"><button>COVID-19 Update</button></a><a href="https://repository.netecweb.org/news#Map"><button>Outbreak Map</button></a><a href="https://repository.netecweb.org/news#News"><button>Newsfeed</button></a><a href="https://repository.netecweb.org/exhibits/show/monkeypox/monkeypox"><button>Monkeypox 2021</button></a><a href="https://repository.netecweb.org/exhibits/show/drcebola2018/drcebola2018"><button>2020 Ebola Update</button></a><a href="https://repository.netecweb.org/ebolatimeline"><button>Ebola Timeline</button></a><a href="https://repository.netecweb.org/exhibits/show/mers/mers"><button>MERS</button></a><a href="https://repository.netecweb.org/exhibits/show/aerosol/aerosol"><button>Airborne Transmission</button></a></span></h2>
<h2 style="background-color:#c7e5f8;">Discover Background Data and Resources:</h2>
<ul><li>
<p><span style="line-height:24px;">Get introduced to NETEC through the interactive timeline of special pathogens below.* This timeline describes some significant special pathogen events in recent history.</span></p>
</li>
<li>
<p><span style="line-height:24px;">Find out more about the 2014 Ebola outbreak and the development of the ASPR/CDC-supported network of healthcare facilities preparing for the next outbreak through <em><a href="/ebolatimeline"><button>the Ebola timeline</button></a>.</em></span></p>
</li>
</ul><ul><li>
<p><span style="line-height:24px;">This NETEC Repository helps to provide training and educational resources to prepare for future special pathogen events. </span></p>
</li>
</ul><ul><li>
<p><span style="line-height:24px;">Explore the files BELOW THE TIMELINE to <em><strong>discover and learn</strong></em> more about Ebola and other Special Pathogens, an overview of special pathogens, clinically managing patients affected, and readying healthcare teams and systems to keep everyone safe.</span></p>
</li>
</ul><h2 style="background-color:#c7e5f8;">Timeline of Special Pathogens:</h2>
<a href="#click">Skip timeline</a>
<p style="margin-bottom:0;"><iframe width="100%" height="635" style="border:1px solid #000000;" src="https://cdn.knightlab.com/libs/timeline3/latest/embed/index.html?source=1AQiHJEzkhEi71uIi7wTWWgSFRwR6wRbRyfhbASrw3Ig&font=Default&lang=en&initial_zoom=2&height=650" title="Timeline of Special Pathogens"></iframe></p>
<h2 style="background-color:#c7e5f8;"><span style="font-size:70%;">*Click for <a href="/timeline2access"><button>a screen reader accessible table of this timeline</button></a>. </span></h2>
</div>
Hyperlink
A link, or reference, to another resource on the Internet.
URL
https://netec.org/2022/06/30/a-clinicians-reference-guide-to-lassa-virus/
Dublin Core
The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.
Title
A name given to the resource
A Clinicians Reference Guide to Lassa Virus
Subject
The topic of the resource
Treatment & Care
Description
An account of the resource
This blog post provides a Clinical Perspective on Lassa Virus from NETEC experts.
Creator
An entity primarily responsible for making the resource
NETEC
Date
A point or period of time associated with an event in the lifecycle of the resource
2022-06-30
Coverage
The spatial or temporal topic of the resource, the spatial applicability of the resource, or the jurisdiction under which the resource is relevant
2023-07-10
Blog
Clinical Care
Lassa
-
https://repository.netecweb.org/files/original/23e789970a5505f6ad01140aecfd6c89.png
cc41ea3fd9a79d52f1d633d1d96c4353
Dublin Core
The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.
Title
A name given to the resource
Discover
Description
An account of the resource
<div style="background-color:#c7e5f8;">
<h2 style="background-color:#c7e5f8;"><span style="font-size:80%;line-height:24px;"><a href="https://repository.netecweb.org/exhibits/show/ncov/ncov"><button>COVID-19 Update</button></a><a href="https://repository.netecweb.org/news#Map"><button>Outbreak Map</button></a><a href="https://repository.netecweb.org/news#News"><button>Newsfeed</button></a><a href="https://repository.netecweb.org/exhibits/show/monkeypox/monkeypox"><button>Monkeypox 2021</button></a><a href="https://repository.netecweb.org/exhibits/show/drcebola2018/drcebola2018"><button>2020 Ebola Update</button></a><a href="https://repository.netecweb.org/ebolatimeline"><button>Ebola Timeline</button></a><a href="https://repository.netecweb.org/exhibits/show/mers/mers"><button>MERS</button></a><a href="https://repository.netecweb.org/exhibits/show/aerosol/aerosol"><button>Airborne Transmission</button></a></span></h2>
<h2 style="background-color:#c7e5f8;">Discover Background Data and Resources:</h2>
<ul><li>
<p><span style="line-height:24px;">Get introduced to NETEC through the interactive timeline of special pathogens below.* This timeline describes some significant special pathogen events in recent history.</span></p>
</li>
<li>
<p><span style="line-height:24px;">Find out more about the 2014 Ebola outbreak and the development of the ASPR/CDC-supported network of healthcare facilities preparing for the next outbreak through <em><a href="/ebolatimeline"><button>the Ebola timeline</button></a>.</em></span></p>
</li>
</ul><ul><li>
<p><span style="line-height:24px;">This NETEC Repository helps to provide training and educational resources to prepare for future special pathogen events. </span></p>
</li>
</ul><ul><li>
<p><span style="line-height:24px;">Explore the files BELOW THE TIMELINE to <em><strong>discover and learn</strong></em> more about Ebola and other Special Pathogens, an overview of special pathogens, clinically managing patients affected, and readying healthcare teams and systems to keep everyone safe.</span></p>
</li>
</ul><h2 style="background-color:#c7e5f8;">Timeline of Special Pathogens:</h2>
<a href="#click">Skip timeline</a>
<p style="margin-bottom:0;"><iframe width="100%" height="635" style="border:1px solid #000000;" src="https://cdn.knightlab.com/libs/timeline3/latest/embed/index.html?source=1AQiHJEzkhEi71uIi7wTWWgSFRwR6wRbRyfhbASrw3Ig&font=Default&lang=en&initial_zoom=2&height=650" title="Timeline of Special Pathogens"></iframe></p>
<h2 style="background-color:#c7e5f8;"><span style="font-size:70%;">*Click for <a href="/timeline2access"><button>a screen reader accessible table of this timeline</button></a>. </span></h2>
</div>
Hyperlink
A link, or reference, to another resource on the Internet.
URL
https://netec.org/2022/06/29/lassa-fever-testing-and-treatments/
Dublin Core
The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.
Title
A name given to the resource
Lassa Fever: Testing and Treatments
Subject
The topic of the resource
Treatment & Care
Description
An account of the resource
Lassa virus infection can result in a broad spectrum of clinical signs and symptoms, from asymptomatic or very minimal symptoms to the severe manifestation, a viral hemorrhagic fever. In addition, the early symptoms of Lassa fever are similar in nature to those of other common viral illnesses, including influenza, which makes it difficult for clinicians to identify early on.<br /><br />This blog post covers information on diagnosing, testing for, and treating Lassa.
Creator
An entity primarily responsible for making the resource
NETEC
Publisher
An entity responsible for making the resource available
2022-06-29
Coverage
The spatial or temporal topic of the resource, the spatial applicability of the resource, or the jurisdiction under which the resource is relevant
2023-07-10
Blog
Diagnosis
Identify
Laboratory Testing
Lassa
Treatment and Care
-
https://repository.netecweb.org/files/original/b3641efec25f32a1bc7a96c708967cc7.png
de3b71669ef5c9eacfca3aed96765472
Dublin Core
The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.
Title
A name given to the resource
Discover
Description
An account of the resource
<div style="background-color:#c7e5f8;">
<h2 style="background-color:#c7e5f8;"><span style="font-size:80%;line-height:24px;"><a href="https://repository.netecweb.org/exhibits/show/ncov/ncov"><button>COVID-19 Update</button></a><a href="https://repository.netecweb.org/news#Map"><button>Outbreak Map</button></a><a href="https://repository.netecweb.org/news#News"><button>Newsfeed</button></a><a href="https://repository.netecweb.org/exhibits/show/monkeypox/monkeypox"><button>Monkeypox 2021</button></a><a href="https://repository.netecweb.org/exhibits/show/drcebola2018/drcebola2018"><button>2020 Ebola Update</button></a><a href="https://repository.netecweb.org/ebolatimeline"><button>Ebola Timeline</button></a><a href="https://repository.netecweb.org/exhibits/show/mers/mers"><button>MERS</button></a><a href="https://repository.netecweb.org/exhibits/show/aerosol/aerosol"><button>Airborne Transmission</button></a></span></h2>
<h2 style="background-color:#c7e5f8;">Discover Background Data and Resources:</h2>
<ul><li>
<p><span style="line-height:24px;">Get introduced to NETEC through the interactive timeline of special pathogens below.* This timeline describes some significant special pathogen events in recent history.</span></p>
</li>
<li>
<p><span style="line-height:24px;">Find out more about the 2014 Ebola outbreak and the development of the ASPR/CDC-supported network of healthcare facilities preparing for the next outbreak through <em><a href="/ebolatimeline"><button>the Ebola timeline</button></a>.</em></span></p>
</li>
</ul><ul><li>
<p><span style="line-height:24px;">This NETEC Repository helps to provide training and educational resources to prepare for future special pathogen events. </span></p>
</li>
</ul><ul><li>
<p><span style="line-height:24px;">Explore the files BELOW THE TIMELINE to <em><strong>discover and learn</strong></em> more about Ebola and other Special Pathogens, an overview of special pathogens, clinically managing patients affected, and readying healthcare teams and systems to keep everyone safe.</span></p>
</li>
</ul><h2 style="background-color:#c7e5f8;">Timeline of Special Pathogens:</h2>
<a href="#click">Skip timeline</a>
<p style="margin-bottom:0;"><iframe width="100%" height="635" style="border:1px solid #000000;" src="https://cdn.knightlab.com/libs/timeline3/latest/embed/index.html?source=1AQiHJEzkhEi71uIi7wTWWgSFRwR6wRbRyfhbASrw3Ig&font=Default&lang=en&initial_zoom=2&height=650" title="Timeline of Special Pathogens"></iframe></p>
<h2 style="background-color:#c7e5f8;"><span style="font-size:70%;">*Click for <a href="/timeline2access"><button>a screen reader accessible table of this timeline</button></a>. </span></h2>
</div>
Hyperlink
A link, or reference, to another resource on the Internet.
URL
https://netec.org/2022/06/21/preventing-lassa-virus-infections-in-health-care-settings/
Dublin Core
The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.
Title
A name given to the resource
Preventing Lassa Virus Infections in Health Care Settings
Subject
The topic of the resource
Infection Control
Description
An account of the resource
This blog post covers information on stopping transmission of Lassa Fever with Infection Prevention and Control and Waste Management.
Creator
An entity primarily responsible for making the resource
NETEC
Date
A point or period of time associated with an event in the lifecycle of the resource
2022-06-21
Coverage
The spatial or temporal topic of the resource, the spatial applicability of the resource, or the jurisdiction under which the resource is relevant
2025-07-20
Relation
A related resource
Y - D0.1PM/D0.2PM Qualtrics # 904, original # 3
Contributor
An entity responsible for making contributions to the resource
2023-07-13 by Christa Arguinchona and Caroline Croyle (PM) - Created in 2022, recommending checking in every 2 years unless significant changes to lassa fever recs
Blog
Healthcare Worker Safety
Infection Prevention and Control
Lassa
Occupational Exposure
Occupational Health
R-PM
-
https://repository.netecweb.org/files/original/2dae7ef45b9c455ed93ab2eaa3d0807c.png
2b3cf447fc1a8c34b058881fb1437101
Dublin Core
The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.
Title
A name given to the resource
Discover
Description
An account of the resource
<div style="background-color:#c7e5f8;">
<h2 style="background-color:#c7e5f8;"><span style="font-size:80%;line-height:24px;"><a href="https://repository.netecweb.org/exhibits/show/ncov/ncov"><button>COVID-19 Update</button></a><a href="https://repository.netecweb.org/news#Map"><button>Outbreak Map</button></a><a href="https://repository.netecweb.org/news#News"><button>Newsfeed</button></a><a href="https://repository.netecweb.org/exhibits/show/monkeypox/monkeypox"><button>Monkeypox 2021</button></a><a href="https://repository.netecweb.org/exhibits/show/drcebola2018/drcebola2018"><button>2020 Ebola Update</button></a><a href="https://repository.netecweb.org/ebolatimeline"><button>Ebola Timeline</button></a><a href="https://repository.netecweb.org/exhibits/show/mers/mers"><button>MERS</button></a><a href="https://repository.netecweb.org/exhibits/show/aerosol/aerosol"><button>Airborne Transmission</button></a></span></h2>
<h2 style="background-color:#c7e5f8;">Discover Background Data and Resources:</h2>
<ul><li>
<p><span style="line-height:24px;">Get introduced to NETEC through the interactive timeline of special pathogens below.* This timeline describes some significant special pathogen events in recent history.</span></p>
</li>
<li>
<p><span style="line-height:24px;">Find out more about the 2014 Ebola outbreak and the development of the ASPR/CDC-supported network of healthcare facilities preparing for the next outbreak through <em><a href="/ebolatimeline"><button>the Ebola timeline</button></a>.</em></span></p>
</li>
</ul><ul><li>
<p><span style="line-height:24px;">This NETEC Repository helps to provide training and educational resources to prepare for future special pathogen events. </span></p>
</li>
</ul><ul><li>
<p><span style="line-height:24px;">Explore the files BELOW THE TIMELINE to <em><strong>discover and learn</strong></em> more about Ebola and other Special Pathogens, an overview of special pathogens, clinically managing patients affected, and readying healthcare teams and systems to keep everyone safe.</span></p>
</li>
</ul><h2 style="background-color:#c7e5f8;">Timeline of Special Pathogens:</h2>
<a href="#click">Skip timeline</a>
<p style="margin-bottom:0;"><iframe width="100%" height="635" style="border:1px solid #000000;" src="https://cdn.knightlab.com/libs/timeline3/latest/embed/index.html?source=1AQiHJEzkhEi71uIi7wTWWgSFRwR6wRbRyfhbASrw3Ig&font=Default&lang=en&initial_zoom=2&height=650" title="Timeline of Special Pathogens"></iframe></p>
<h2 style="background-color:#c7e5f8;"><span style="font-size:70%;">*Click for <a href="/timeline2access"><button>a screen reader accessible table of this timeline</button></a>. </span></h2>
</div>
Hyperlink
A link, or reference, to another resource on the Internet.
URL
https://netec.org/2022/06/13/lassa-fever-patient-care-biocontainment-ppe/
Dublin Core
The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.
Title
A name given to the resource
Lassa Fever: Biocontainment and PPE for Patient Care
Subject
The topic of the resource
Infection Control
Description
An account of the resource
This blog post covers infection control, biocontainment, PPE, and related topics for Lassa Fever patients. <br /><br />Because of the high degree of mortality associated with infection, patients infected with or suspected to be infected with Lassa virus should be cared for in a biocontainment unit and health care providers should follow personal protective equipment (PPE) guidance to prevent secondary person-to-person spread.
Creator
An entity primarily responsible for making the resource
NETEC
Date
A point or period of time associated with an event in the lifecycle of the resource
2022-06-13
Coverage
The spatial or temporal topic of the resource, the spatial applicability of the resource, or the jurisdiction under which the resource is relevant
2023-07-20
Identifier
An unambiguous reference to the resource within a given context
Infection Prevention and Control; PPE
Blog
Intake
Internal Transport
Isolate
Isolation/Biocontainment
Lassa
Personal Protective Equipment (PPE)
Treatment and Care
-
https://repository.netecweb.org/files/original/1f706c4decb828ee0c4a3749057ddcec.png
e413af79e9db5c92478b6da466700819
Dublin Core
The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.
Title
A name given to the resource
Discover
Description
An account of the resource
<div style="background-color:#c7e5f8;">
<h2 style="background-color:#c7e5f8;"><span style="font-size:80%;line-height:24px;"><a href="https://repository.netecweb.org/exhibits/show/ncov/ncov"><button>COVID-19 Update</button></a><a href="https://repository.netecweb.org/news#Map"><button>Outbreak Map</button></a><a href="https://repository.netecweb.org/news#News"><button>Newsfeed</button></a><a href="https://repository.netecweb.org/exhibits/show/monkeypox/monkeypox"><button>Monkeypox 2021</button></a><a href="https://repository.netecweb.org/exhibits/show/drcebola2018/drcebola2018"><button>2020 Ebola Update</button></a><a href="https://repository.netecweb.org/ebolatimeline"><button>Ebola Timeline</button></a><a href="https://repository.netecweb.org/exhibits/show/mers/mers"><button>MERS</button></a><a href="https://repository.netecweb.org/exhibits/show/aerosol/aerosol"><button>Airborne Transmission</button></a></span></h2>
<h2 style="background-color:#c7e5f8;">Discover Background Data and Resources:</h2>
<ul><li>
<p><span style="line-height:24px;">Get introduced to NETEC through the interactive timeline of special pathogens below.* This timeline describes some significant special pathogen events in recent history.</span></p>
</li>
<li>
<p><span style="line-height:24px;">Find out more about the 2014 Ebola outbreak and the development of the ASPR/CDC-supported network of healthcare facilities preparing for the next outbreak through <em><a href="/ebolatimeline"><button>the Ebola timeline</button></a>.</em></span></p>
</li>
</ul><ul><li>
<p><span style="line-height:24px;">This NETEC Repository helps to provide training and educational resources to prepare for future special pathogen events. </span></p>
</li>
</ul><ul><li>
<p><span style="line-height:24px;">Explore the files BELOW THE TIMELINE to <em><strong>discover and learn</strong></em> more about Ebola and other Special Pathogens, an overview of special pathogens, clinically managing patients affected, and readying healthcare teams and systems to keep everyone safe.</span></p>
</li>
</ul><h2 style="background-color:#c7e5f8;">Timeline of Special Pathogens:</h2>
<a href="#click">Skip timeline</a>
<p style="margin-bottom:0;"><iframe width="100%" height="635" style="border:1px solid #000000;" src="https://cdn.knightlab.com/libs/timeline3/latest/embed/index.html?source=1AQiHJEzkhEi71uIi7wTWWgSFRwR6wRbRyfhbASrw3Ig&font=Default&lang=en&initial_zoom=2&height=650" title="Timeline of Special Pathogens"></iframe></p>
<h2 style="background-color:#c7e5f8;"><span style="font-size:70%;">*Click for <a href="/timeline2access"><button>a screen reader accessible table of this timeline</button></a>. </span></h2>
</div>
Hyperlink
A link, or reference, to another resource on the Internet.
URL
https://netec.org/2022/06/06/what-you-need-to-know-about-lassa-fever/
Dublin Core
The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.
Title
A name given to the resource
Lassa Fever: What You Need to Know as Outbreaks Continue
Subject
The topic of the resource
General
Description
An account of the resource
This blog post covers the basics of what you need to know about Lassa Fever: Transmission, Symptoms, and Signs.<br /><br />Lassa fever is an animal-borne, or zoonotic, acute viral hemorrhagic illness endemic in parts of West Africa including Sierra Leone, Liberia, Guinea, and Nigeria. Neighboring countries are also at risk, as the animal vector for Lassa virus, the “multimammate rat” (Mastomys natalensis) is distributed throughout the region (<a href="https://www.cdc.gov/vhf/lassa/index.html" target="_blank" rel="noreferrer noopener">CDC</a>).
Creator
An entity primarily responsible for making the resource
NETEC
Date
A point or period of time associated with an event in the lifecycle of the resource
2022-06-06
Coverage
The spatial or temporal topic of the resource, the spatial applicability of the resource, or the jurisdiction under which the resource is relevant
2023-07-20
Blog
Emergency Management
Identify
Lassa
Outbreaks
-
https://repository.netecweb.org/files/original/4a393c9dc58620a0303e2b049704c66e.png
07a6c38b053cb68867c3624a96ccf222
Dublin Core
The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.
Title
A name given to the resource
Develop
Description
An account of the resource
<h2><span>These files will help you <strong><em>develop</em></strong> your program and plans based on what you have discovered.</span></h2>
<p style="font-size:120%;">Find model protocols and procedures and more in-depth training resources. You can go to the <a href="/exhibits/show/leadership"><button>Leadership Toolbox</button></a> or the <a href="https://repository.netecweb.org/exhibits/show/specialpopulations"><button>Special Populations</button></a> section. You can also go to the <a href="https://repository.netecweb.org/exhibits/show/netec-education/justintime"><button> Just in Time Training</button></a> page, the <a href="https://repository.netecweb.org/exhibits/show/ppe101/ppe"><button> PPE</button></a> page, or the <a href="https://repository.netecweb.org/exhibits/show/ems/prehospital"><button>EMS</button></a> page. <span>Subscribe to the NETEC <a href="https://www.youtube.com/channel/UCDpHc1LkcEpiWR0q7ll5eZQ" target="_blank" rel="noreferrer noopener"><button>Youtube Channel</button></a> to get all new Skills videos!</span></p>
Hyperlink
A link, or reference, to another resource on the Internet.
URL
https://netec.org/transmission-interrupted/lassa-fever-a-summary-for-clinicians/
Dublin Core
The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.
Title
A name given to the resource
Lassa Fever: a Summary for Clinicians
Subject
The topic of the resource
Treatment & Care
Description
An account of the resource
On this episode of Transmission Interrupted, we welcome Dr. Jared Evans, Dr. Aneesh Mehta, and Dr. Vanessa Rabbe—members of NETEC’s Special Pathogen Research Network—to discuss their recent manuscript entitled, “Lassa Virus Infection: a Summary for Clinicians.” Developed from a clinical perspective, this manuscript provides clinicians with a condensed, accessible understanding of the current literature on Lassa virus (LASV) infection and Lassa fever disease (LF). The topics discussed in this episode will provide basic information on Lassa virus and Lassa fever, and will highlight pathogenesis, clinical features, and medical countermeasures that have demonstrated potential value for use in clinical or research environments.
Creator
An entity primarily responsible for making the resource
NETEC
Date
A point or period of time associated with an event in the lifecycle of the resource
2022-06-29
Coverage
The spatial or temporal topic of the resource, the spatial applicability of the resource, or the jurisdiction under which the resource is relevant
2023-07-20
Blog
Lassa
Podcast
Treatment and Care
-
https://repository.netecweb.org/files/original/51c2c26c2f346382fc8db5651c560aa1.pdf
c52eb229a3b45de793a7ea3dccbe7c8d
PDF Text
Text
Viral Hemorrhagic Fevers (VHFs)
This group of infectious diseases is caused by several distinct viral families. The term VHF
describes the conditions these pathogens can cause, which may affect many body systems,
including damaging the cardiovascular system. Some of these viruses produce mild disease,
while others can interfere with blood clotting, cause severe disease, and death.
Basic Viral Hemorrhagic Fever Signs & Symptoms:
VHFs share similar symptoms, including fever, headache, muscle or joint pain, nausea/vomiting, and fatigue. Patients
may present without obvious signs of bleeding.
CDC Information on Assessing VHF Risk in a Returning Traveler
Click Here
Viral Hemorrhagic Fever Testing:
Testing for VHFs may require coordination with public health, CDC, and the Viral Special Pathogens Branch.
CDC Information on Submitting Specimens to the Viral Special Pathogens Branch
Click Here
Viral Hemorrhagic Fever Cleaning & Disinfection:
VHFs are RNA, lipid-enveloped viruses. This makes them susceptible to many cleansers and surface disinfectants.
EPA List of Disinfectants for Emerging Viral Pathogens (EVPs)
Click Here
Remember: As soon as a VHF is suspected, initiate precautions
Identify
Early suspicion (symptoms, exposure, travel) and recognition help protect everyone.
Isolate
Choose PPE in conjunction with engineering and≈administrative controls; consider the potential infectious agent, patient
condition, your level of interaction, and tasks to be performed. https://www.cdc.gov/niosh/topics/hierarchy/default.html.
Inform
Promptly notify appropriate internal and external stakeholders,
including your infection prevention and public health professionals.
6.22.2023
�Personal Protective Equipment and Precautions
CDC Guidance on PPE Selection:
https://www.cdc.gov/niosh/npptl/topics/protectiveclothing/default.html
https://www.cdc.gov/vhf/ebola/healthcare-us/ppe/index.html
Full body coverage: coverall or gown, shoe or boot covers,
and a head cover, hood, or shroud. This ensemble is used for
VHFs patients who are 'wet' - a term used to indicate patients
who are diaphoretic, vomiting, bleeding, or having diarrhea.
Blood and viral penetration resistance: gown = ANSI/AAMI PB70
Level 4 or coverall = ASTM F1671 or EN14126.
Standard precautions: include hand hygiene, the use of
gloves and other articles of PPE to prevent exposure to
blood and other potentially infectious materials, respiratory
etiquette, and safe sharps, injection, and lab practices.
Contact precautions: For known or suspected infections
that can be transmitted by touch or contamination of
surfaces and equipment. PPE = gloves and isolation gown.
Droplet precautions: For known or suspected infections
with pathogens that are transmitted when coughing,
sneezing, or speaking. Use source control mask on the
patient when able and when the patient is outside of the
private room or care area. PPE = medical face mask and eye
protection. Eyes, nose, and mouth should remain fully
covered while in close proximity to patient.
Isolation gown: choose the level of gown based on risk.
AAMI PB70 Level 1 – 3 have increasing levels of resistance to
fluids, and Level 4 is tested for viral penetration.
Eye protection: full face shield or goggles with
circumferential protection.
Airborne precautions: For patients with or suspected of
Respiratory protection: N95 or higher filtering face piece
respirator or PAPR (powered air purifying respirator).
Medical or surgical mask: for droplet or source protection
only. They do not provide respiratory protection.
Gloves: non-sterile medical exam gloves. Double gloving and
the use of extended cuff gloves may be advised.
6.22.2023
having a pathogen that can be transmitted by fine mist,
aerosol particles, and droplet nuclei, such as measles,
chicken pox, disseminated zoster (shingles), and
tuberculosis (TB). Use Airborne Infection Isolation Room
(AIIR) and source control mask on the patient when able.
PPE = fit-tested N95 respirator or higher.
Eye protection: Goggles or safety glasses that provide a
barrier from all sides; or a full-face shield that extends past
the sides of the face and to the chin.
�Virus Family
Common
Geography
Illness Caused
Ebola Virus Disease
Central, subSaharan Africa
Filoviridae
Marburg virus
Lassa fever
Arenaviridae
Junín
Machupo (Bolivian HF)
Guanarito (Venezuelan HF)
Sabia (Brazilian HF)
South America
Europe,
Mediterranean,
Middle East,
Africa, India, China
Hemorrhagic Fever
? Presumed
bat
YES
Fruit bat
Precautions
PPE
Contact,
Droplet/Airborne,
Eye
Rodents
YES
Tick, infected
livestock
Contact,
Droplet/Airborne,
Eye
YES
Contact,
Droplet/Airborne,
Eye
Worldwide
Rodent
Possible
Standard
Precautions unless
Andes virus
suspected
All of sub-Saharan
Africa
Mosquito
No
Standard
Precautions
Yellow Fever
Tropics
Mosquito
Blood 1
Dengue
Tropics
Mosquito
No
Tick
No
Hantaviruses
(HPS/HFRS*)
(Sin Nombre, Andes virus)
Rift Valley Fever
Flaviviridae
Person-toperson spread
West Africa
CCHF – Crimean Congo
Bunyaviridae
Vector or
Source
Kyanasur
India
Omsk
Siberia
HPS* - Hantavirus Pulmonary Syndrome
Comments
Dry phase =
impermeable gown to
mid-calf
Wet phase = Full body
coverage
Dry phase =
impermeable gown to
mid-calf
Wet phase = full body
coverage
Dry phase =
impermeable gown to
mid-calf
Wet phase = Full body
coverage
Contact,
Droplet/Airborne, Eye
for potential Andes
virus or contact/cleanup of rodent droppings
1 Potential risk of
Standard
Precautions
Yellow Fever
transmission in blood
transfusion, or
immediately post
vaccination
HFRS* - Hemorrhagic Fever with Renal Syndrome
Yellow Fever - 1 Transmission of the vaccine strain of Yellow Fever can occur thru blood transfusion and breastmilk. Blood donation & breastfeeding should
be avoided for 2 weeks after vaccination.
Full body coverage
Gown
Respiratory protection
by N95 or higher
Medical or
surgical mask
6.22.2023
Gloves
Eye protection
�
Dublin Core
The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.
Title
A name given to the resource
Develop
Description
An account of the resource
<h2><span>These files will help you <strong><em>develop</em></strong> your program and plans based on what you have discovered.</span></h2>
<p style="font-size:120%;">Find model protocols and procedures and more in-depth training resources. You can go to the <a href="/exhibits/show/leadership"><button>Leadership Toolbox</button></a> or the <a href="https://repository.netecweb.org/exhibits/show/specialpopulations"><button>Special Populations</button></a> section. You can also go to the <a href="https://repository.netecweb.org/exhibits/show/netec-education/justintime"><button> Just in Time Training</button></a> page, the <a href="https://repository.netecweb.org/exhibits/show/ppe101/ppe"><button> PPE</button></a> page, or the <a href="https://repository.netecweb.org/exhibits/show/ems/prehospital"><button>EMS</button></a> page. <span>Subscribe to the NETEC <a href="https://www.youtube.com/channel/UCDpHc1LkcEpiWR0q7ll5eZQ" target="_blank" rel="noreferrer noopener"><button>Youtube Channel</button></a> to get all new Skills videos!</span></p>
Guide
Document providing operation or response information, general guidance documents.
Dublin Core
The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.
Title
A name given to the resource
Viral Hemorrhagic Fevers (VHFs) Matrix
Subject
The topic of the resource
Infection Control
Description
An account of the resource
This group of infectious diseases is caused by several distinct viral families. The term VHF describes the conditions these pathogens can cause, which may affect many body systems, including damaging the cardiovascular system. Some of these viruses produce mild disease, while others can interfere with blood clotting, cause severe disease, and death.<br /><br />This document provides information Personal Protective Equipment and Precautions, and PPE selection for Viral Hemorrhagic Fevers.
Creator
An entity primarily responsible for making the resource
NETEC
Date
A point or period of time associated with an event in the lifecycle of the resource
2023-06-22
Coverage
The spatial or temporal topic of the resource, the spatial applicability of the resource, or the jurisdiction under which the resource is relevant
2024-06-22
Argentine Hemorrhagic Fever
Crimean Congo Haemorrhagic Fever (CCHF)
Ebola
Junín virus
Lassa
Marburg
Personal Protective Equipment (PPE)
R-PPE
South American Hemorrhagic Fever
Viral Hemorrhagic Fever
-
https://repository.netecweb.org/files/original/a193e546a23acf438c8bcb7bacb7a4cb.png
5422fa180364ca849396d3977b53b654
https://repository.netecweb.org/files/original/7094671700d8ca13dc461b091d64acd2.pdf
7d477a0cb8fcd33730d350fc515afe8c
PDF Text
Text
Health Care Facility Viral Hemorrhagic Fever (VHF)
Preparedness Checklist
Viral Hemorrhagic Fevers (VHF) are a group of diseases caused by several families of viruses. The term VHF refers to an illness that can affect
multiple organ systems and can be accompanied by fever, headache, vomiting, abdominal pain, diarrhea, and hemorrhage. VHFs addressed
in this document include Crimean-Congo Hemorrhagic Fever (CCHF), Ebola Virus Disease (EVD), Lassa Fever, and Marburg Virus Disease
(MVD).
Health care facility preparedness to care for patients with a viral hemorrhagic fever (VHF) is essential to prevent transmission to staff, other
patients and our communities. To assist healthcare facilities assess and advance their VHF preparedness, the National Emerging Special
Pathogens Training and Education Center (NETEC) developed the Health Care Facility Viral Hemorrhagic Fever Preparedness Checklist as a
VHF planning tool. This tool will help health care facilities assess their readiness to identify, isolate, inform, and provide initial treatment for
patients suspected or confirmed to have a VHF.
This checklist is intended to guide facilities through a review of their immediate care capabilities and provide resources to assist in the
resolution of preparedness gaps it reveals.
For a more in-depth assessment of your special pathogen program, we recommend requesting to complete the NETEC Special Pathogen
Operational Readiness Self-Assessment (SPORSA). Visit www.NETEC.org for more information.
1 | The National Emerging Special Pathogens Training and Education Center (NETEC) | netec.org
�IDENTIFY ......................................................................................................................................................................................... 3
Identify Readiness Items ................................................................................................................................................................................ 3
Identify Resource/ Guidance ......................................................................................................................................................................... 3
Isolate ............................................................................................................................................................................................. 5
Isolate Readiness Items .................................................................................................................................................................................. 5
Isolation Resources/ Guidance ....................................................................................................................................................................... 6
Inform ............................................................................................................................................................................................. 8
Inform Readiness Items .................................................................................................................................................................................. 8
Inform Resources/ Guidance .......................................................................................................................................................................... 8
Personal Protective Equipment (PPE) ............................................................................................................................................... 9
PPE Readiness Items ...................................................................................................................................................................................... 9
PPE Resources/ Guidance ............................................................................................................................................................................. 10
Treatment & Care .......................................................................................................................................................................... 11
Treatment and Care Readiness Items ........................................................................................................................................................... 11
Treatment and Care Resources/ Guidance.................................................................................................................................................... 12
Waste Management and Cleaning & Disinfection .......................................................................................................................... 13
Waste Management and Cleaning and disinfection Items ............................................................................................................................ 13
Waste Management Resources/ Guidance ................................................................................................................................................... 14
Transportation .............................................................................................................................................................................. 15
Transportation Readiness Items ................................................................................................................................................................... 15
Transportation Resources/Guidance ............................................................................................................................................................ 15
2 | The National Emerging Special Pathogens Training and Education Center (NETEC) | netec.org
�IDENTIFY
The first step in the VHF response framework for health care facilities is to quickly recognize and safely manage patients with a suspected or
confirmed VHF to reduce transmission risk. Screening all patients upon entry to a facility for signs, symptoms, and epidemiological risk
factors for VHFs will facilitate early identification of a patient at risk for having the disease.
Identify Readiness Items
#
1.
2.
3.
4.
Item
There is an established process to complete periodic review of countries
where VHFs are endemic or are currently experiencing VHF outbreaks.
Screening for symptoms and travel history occurs at all points of patient
entry to the facility including those arriving by EMS.
Signage is present at all points of entry into the health system to enable
patients to self-identify if their symptoms are consistent with a VHF and what
next steps are (e.g., mask and notify staff).
Staff who will complete patient screening have received training on the VHF
“Identify” process.
Status
Notes
Yes or No
Yes ☐ Click here to enter facility notes.
No ☐
Yes ☐ Click here to enter facility notes.
No ☐
Yes ☐ Click here to enter facility notes.
No ☐
Yes ☐ Click here to enter facility notes.
No ☐
Identify Resource/ Guidance
NETEC Town Hall: Preparing Frontline Health Care Workers for Ebola
https://youtu.be/Okh_Sa9cVa4
Identify Worksheet:
https://repository.netecweb.org/files/original/c1c81476c9626fd1d8f8be5fa75f9ad3.pdf
Global Outbreak Resources:
https://www.cdc.gov/outbreaks/index.html
https://dph.georgia.gov/TravelClinicalAssistant
3 | The National Emerging Special Pathogens Training and Education Center (NETEC) | netec.org
�Screening Algorithm Example:
https://repository.netecweb.org/items/show/458 [repository.netecweb.org]
Identify Isolate Inform Webinar/ Course:
https://youtu.be/QkGflp7W7Cc
https://courses.netec.org/courses/identify-isolate-inform
Mystery Patient Drill Kit:
https://repository.netecweb.org/pdfs/specialpathogenmysterydrill.zip
4 | The National Emerging Special Pathogens Training and Education Center (NETEC) | netec.org
�ISOLATE
The second step of the VHF response framework for health care facilities is to safely isolate and manage patients with a suspected or
confirmed VHF to reduce transmission risk. Rapid isolation allows infection prevention and control measures to be implemented to reduce
exposure to staff, visitors, and other patients.
Isolate Readiness Items
#
1.
2.
2a.
2b.
2c.
2d.
2e.
2f.
Item
Masks are available at all points of entry for patients entering the facility to
quickly apply if indicated.
An isolation space has been identified and:
Staff are oriented to its location, use, and limitations.
The process for using the space has been developed and tested
(e.g., moving out other patients or extra equipment, initiating
negative pressure).
A written checklist has been developed to direct the preparation of
the isolation space.
There is a private restroom or bedside commode available for the
patient to use in accordance with facility and jurisdictional
regulations for human waste management.
The isolation space is an airborne infection isolation room (AIIR) or
can accommodate a portable negative pressure unit if needed and
available. **
There is a process for communication to occur into and out of the
room, while maintaining isolation precautions (e.g., white boards,
speaker phones, call light system).
Status
Notes
Yes or No
Yes ☐ Click here to enter facility notes.
No ☐
Yes ☐ Click here to enter facility notes.
No ☐
Yes ☐ Click here to enter facility notes.
No ☐
Click here to enter facility notes.
Yes ☐
No ☐
Yes ☐ Click here to enter facility notes.
No ☐
Click here to enter facility notes.
Yes ☐
No ☐
Yes ☐
No ☐
Yes ☐
No ☐
Click here to enter facility notes.
Click here to enter facility notes.
5 | The National Emerging Special Pathogens Training and Education Center (NETEC) | netec.org
�2g.
2h.
3.
3a.
3b.
3c.
3d.
There is a process to limit the number of personnel that enter the
isolation space to essential personnel.
There is a process to clearly identify, document, and follow up with
all personnel that enter the isolation space.
There is a written plan for the internal transfer of a patient from the point
of entry into the facility to the designated isolation space.
The written plan includes the following:
Ability to control the internal route to the isolation space,
minimizing risk of exposure to others.
Preparing the isolation space for the patient arrival including
isolation signage and delineation of zones.
Guidance on safely managing the patient until the isolation space
is ready for admission (e.g., masking and maintaining 6ft distance
from other patients, visitors, and staff)
Personnel who have current training to implement the plan.
Staff who will work in the isolation area have been trained on special
pathogen workflows and processes.
*Refer to the Isolation Worksheet in Resources for more detailed guidance
4.
Yes ☐ Click here to enter facility notes.
No ☐
Yes ☐ Click here to enter facility notes.
No ☐
Click here to enter facility notes.
Yes ☐
No ☐
Yes ☐ Click here to enter facility notes.
No ☐
Yes ☐ Click here to enter facility notes.
No ☐
Click here to enter facility notes.
Yes ☐
No ☐
Yes ☐ Click here to enter facility notes.
No ☐
Yes ☐ Click here to enter facility notes.
No ☐
**If there are no AIIR and portable negative pressure devices are not available, identify a private, closed-door room that the patient can be
placed in while remaining masked.
Isolation Resources/ Guidance
Isolation Worksheet:
https://repository.netecweb.org/files/original/77003e56292b75db4d90bccdea9120ca.pdf
CDC Guidance on Hospital Room Infection Control for Ebola Virus:
https://www.cdc.gov/vhf/ebola/clinicians/cleaning/hospitals.html
6 | The National Emerging Special Pathogens Training and Education Center (NETEC) | netec.org
�Containment Wrap Protocol:
https://repository.netecweb.org/files/original/b68363bffb7eec4a6189ada3a480317f.pdf
Log Sheet:
https://repository.netecweb.org/files/original/78157aefeb472e0d99e0300509f72a1a.pdf
7 | The National Emerging Special Pathogens Training and Education Center (NETEC) | netec.org
�INFORM
The third step of the VHF response framework for health care facilities is to promptly notify key partners to reduce transmission risk. Timely
and efficient communication processes are essential to be able to alert internal and external stakeholders of the identification of a patient
suspected to have a VHF. External stakeholders, such as a Department of Public Health, may also be needed to determine if a patient meets
VHF PUI criteria.
Inform Readiness Items
#
1.
2.
3.
4.
Item
Key personnel internal (e.g., Infection preventionists, health care
administrator, etc.) to your facility who will provide support and/or be
involved in the care of a PUI have been identified.
Key partners both internal and external to your facility, such as county and
state public health partners and Laboratory Response Network (LRN)
partners, have been identified and staff know who to inform.
Contact information for internal and external key personnel is readily
accessible.
Staff who will inform key personnel are knowledgeable on the process,
including what information to provide.
Status
Yes or No
Yes ☐
No ☐
Yes ☐
No ☐
Notes
Click here to enter facility notes.
Click here to enter facility notes.
Yes ☐ Click here to enter facility notes.
No ☐
Yes ☐ Click here to enter facility notes.
No ☐
Inform Resources/ Guidance
Inform Worksheet:
https://repository.netecweb.org/files/original/a537618495fdb8be570540cb604ca035.pdf
CDC Health Alert Network:
https://emergency.cdc.gov/han/
Health Department Directories:
https://www.cdc.gov/publichealthgateway/healthdirectories/index.html
8 | The National Emerging Special Pathogens Training and Education Center (NETEC) | netec.org
�PERSONAL PROTECTIVE EQUIPMENT (PPE)
PPE ensembles worn during the care of patients suspected or confirmed to have a VHF must provide enhanced contact and droplet
protection and should consider both the condition of the patient and the risk of exposure to blood and other potentially infectious materials
posed by care tasks. Complex and infrequently used PPE ensembles require additional training to ensure staff safety and may require
additional personnel to assist in doffing. The use of a trained observer is recommended to ensure correct donning and safe doffing practices
to reduce self-contamination.
PPE Readiness Items
#
1.
2.
3.
4.
5.
6.
Item
The PPE ensemble has been selected based on pathogen transmission and
patient condition (, e.g., wet vs dry) and includes consideration to elevate
based on presumptive positive test results.
Staff have received training on VHF PPE donning and doffing protocols.
There is a clean space to don PPE and a separate safe space to doff PPE.
There are PPE donning and doffing checklists to guide staff utilizing PPE
ensembles.
There is an adequate amount of appropriate PPE available to provide care
for at least 1 patient for 24-48 hours. See DASH tool HERE for guidance on
determining facility PPE supply needs.
A trained observer is utilized to monitor activities in the isolation room and
donning and doffing of PPE.
Status
Yes or No
Yes ☐
No ☐
Notes
Click here to enter facility notes.
Yes ☐ Click here to enter facility notes.
No ☐
Yes ☐ Click here to enter facility notes.
No ☐
Yes ☐ Click here to enter facility notes.
No ☐
Click here to enter facility notes.
Yes ☐
No ☐
Yes ☐ Click here to enter facility notes.
No ☐
9 | The National Emerging Special Pathogens Training and Education Center (NETEC) | netec.org
�PPE Resources/ Guidance
ASPR/TRACIE Disaster Available Supplies in Hospitals (DASH) tool:
https://dashtool.org
CDC PPE Guidance for Ebola Virus Care:
https://www.cdc.gov/vhf/ebola/healthcare-us/ppe/guidance.html
Know Your PPE:
https://repository.netecweb.org/items/show/1053
Space Recommendations for Donning and Doffing Personal Protective Equipment (PPE) in Biocontainment Areas:
https://repository.netecweb.org/items/show/1708
Viral Hemorrhagic Fevers PPE Matrix:
https://repository.netecweb.org/files/original/8c1dda9b0654d3013ddc57a29b960ab2.pdf
10 | The National Emerging Special Pathogens Training and Education Center (NETEC) | netec.org
�TREATMENT & CARE
The goal of caring for patients suspected or confirmed to have a VHF is to provide safe, effective, high-quality patient care while maintaining
the safety of all personnel.
Treatment and Care Readiness Items
#
1.
2.
3.
4.
5.
6.
7.
Item
If a PUI arrives at your facility, personnel are familiar with internal processes
and have access to resources for just-in-time-training.
The care interventions that can be safely provided for patients suspected or
confirmed to have VHF have been discussed and clinicians are aware of how
to safely offer care including expansion of duties to reduce the number of
staff (clinical and non-clinical) in the patient’s room (e.g., diagnostic
imaging, invasive procedures, specimen collection).
There is a written plan to collaborate with employee health and/or public
health to monitor personnel involved in the care of a patient with a
confirmed diagnosis. (including laboratory personnel who may have
handled biospecimens or EVS who may have managed environmental
cleaning and disinfection).
Diagnostic testing for presumptive and confirmatory pathogen identification
will be conducted in coordination with the public health department.
If routine clinical laboratory testing is required, either dedicated point of
care devices will be used, or risk assessment of the main clinical laboratory
completed to determine what tests can be safely performed.
The facility has access to resources for guidance on packaging and shipment
of presumed category A specimens.
The facility is aware of and has identified available resources for decedent
management and will seek support to conduct the process if needed.
Status
Notes
Yes or No
Yes ☐ Click here to enter facility notes.
No ☐
Click here to enter facility notes.
Yes ☐
No ☐
Click here to enter facility notes.
Yes ☐
No ☐
Yes ☐ Click here to enter facility notes.
No ☐
Click here to enter facility notes.
Yes ☐
No ☐
Yes ☐ Click here to enter facility notes.
No ☐
Yes ☐ Click here to enter facility notes.
No ☐
11 | The National Emerging Special Pathogens Training and Education Center (NETEC) | netec.org
�Treatment and Care Resources/ Guidance
Treatment and Care Worksheet:
https://repository.netecweb.org/files/original/71028eadfb30cd38c0ba31e01a5fa28a.pdf
JIT Training Resources:
https://repository.netecweb.org/exhibits/show/netec-education/justintime
Laboratory Testing for Crimean-Congo Hemorrhagic Fever:
https://repository.netecweb.org/items/show/1698
Laboratory Testing for Ebola:
https://netec.org/2022/10/11/laboratory-testing-for-ebola/
Laboratory Testing for Lassa Fever:
https://repository.netecweb.org/items/show/1667
Laboratory Testing for Marburg:
https://repository.netecweb.org/exhibits/show/netec_guides/item/1705
Laboratory Activation Checklist:
https://repository.netecweb.org/files/original/760672f218efe45fdf61c2d96991b2c2.docx
12 | The National Emerging Special Pathogens Training and Education Center (NETEC) | netec.org
�WASTE MANAGEMENT AND CLEANING & DISINFECTION
Waste generated in the care of suspected or confirmed to have a viral hemorrhagic fever (VHF) is subject to procedures set forth by local,
state, and federal regulations. Basic principles for spills of blood and other potentially infectious materials are outlined in the U.S.
Occupational Safety and Health Administration (OSHA). Waste contaminated (or suspected to be contaminated) with certain VHFs is a
Category A infectious substance regulated by the U.S. Department of Transportation Hazardous Materials Regulations (HMR; 49 CFR, Parts
171-180). Requirements in the HMR apply to any material DOT determines is capable of posing an unreasonable risk to health, safety, and
property when transported in commerce. The EPA maintains lists of registered disinfectants that should be used to destroy certain
pathogens. For a list of disinfectants that are effective against the VHF and analogous pathogens visit https://www.epa.gov/pesticideregistration/list-l-disinfectants-use-against-ebola-virus#check.
Waste Management and Cleaning and disinfection Items
#
1.
1a.
1b.
1c.
1d.
Item
There is a written plan for the management of waste generated during the
care of a person suspected or confirmed to have a pathogen and it includes
the following:
A designated secured waste holding area where waste can be
separated from the department and facility’s normal waste holding
area.
Staff training on high-risk biohazard waste management process
including proper handling of human biological waste, used and
unused medical equipment, used and unused disposable supplies,
patient linen and clothing, and terminal cleaning of patient room.
Secure packaging/ containment of waste to include proper closure
of biohazard bags and approved hard sided transport containers.
If required, a vendor licensed to transport category A infectious
substance will transport the waste for off-site inactivation.
Status
Yes or No
Yes ☐
No ☐
Yes ☐
No ☐
Notes
Click here to enter facility notes.
Click here to enter facility notes.
Click here to enter facility notes.
Yes ☐
No ☐
Yes ☐ Click here to enter facility notes.
No ☐
Yes ☐ Click here to enter facility notes.
No ☐
13 | The National Emerging Special Pathogens Training and Education Center (NETEC) | netec.org
�2.
2a.
2b.
2c.
2d.
There is a written cleaning and disinfection plan for the isolation area that
includes the following:
Guidance on the type of PPE to be worn when performing cleaning
and disinfection in the special pathogen isolation area.
A process to ensure an appropriate disinfectant has been selected
and is available for use that is effective against the pathogen.
Detailed checklist(s) that guide staff in all steps to ensure safe and
effective management of the space after the patient has been
discharged or transferred.
Guidance and oversight of the cleaning and disinfection process by a
special pathogens infection control expert.
Yes ☐ Click here to enter facility notes.
No ☐
Yes ☐ Click here to enter facility notes.
No ☐
Yes ☐ Click here to enter facility notes.
No ☐
Click here to enter facility notes.
Yes ☐
No ☐
Yes ☐ Click here to enter facility notes.
No ☐
Waste Management Resources/ Guidance
Managing Solid Waste Contaminated with a Category A Infectious Substance:
https://www.phmsa.dot.gov/sites/phmsa.dot.gov/files/2022-06/Cat%20A%20Waste%20Planning%20Guidance_Final_2022_06.pdf
Ebola-Associated Waste Management:
https://www.cdc.gov/vhf/ebola/clinicians/cleaning/waste-management.html
Fact Sheet. Safe Handlin, Treatment, Transport and Disposal of Ebola-Contaminated Waste:
https://www.osha.gov/sites/default/files/publications/OSHA_FS-3766.pdf
COVID-19 Waste Container Use:
https://repository.netecweb.org/files/original/7cc5c14094799b74298210150878a02f.pdf
Interim Guidance for Environmental Infection Control in Hospitals for Ebola Virus:
https://www.cdc.gov/vhf/ebola/clinicians/cleaning/hospitals.html
14 | The National Emerging Special Pathogens Training and Education Center (NETEC) | netec.org
�TRANSPORTATION
Patients suspected or confirmed to have a VHF may require transportation either to or from your facility. Having a plan in place will facilitate
the movement of the patient in a manner that maintains safety for facility and transportation staff.
Transportation Readiness Items
#
1.
1a.
1b.
2.
Item
There is a written plan to request the transfer of a patient suspected or
confirmed to have a VHF that includes:
Current contact information for local and state public health authorities, an
identified EMS agency that can provide ACLS and/or BLS transport as
needed, and a higher tier facility that the patient can be transferred to.
Guidance on how to prepare the patient for transport (e.g., protective
ensemble and premedication considerations)
Your facility has identified a specific location and established processes for
the transfer of patient care between EMS personnel and facility personnel.
Status
Notes
Yes or No
Yes ☐ Click here to enter facility notes.
No ☐
Click here to enter facility notes.
Yes ☐
No ☐
Yes ☐ Click here to enter facility notes.
No ☐
Yes ☐ Click here to enter facility notes.
No ☐
Transportation Resources/Guidance
Example: Standard Operating Procedure (SOP) for Decontamination of an Ambulance that has Transported a Person under Investigation or
Patient with Confirmed Ebola:
https://www.cdc.gov/vhf/ebola/clinicians/emergency-services/ambulance-decontamination.html
EMS Infectious Disease Playbook:
https://www.ems.gov/pdf/ASPR-EMS-Infectious-Disease-Playbook-June-2017.pdf
Example: Standard Operating Procedure (SOP) for Patient Handoff between a Health care Facility and a Transporting Ambulance:
https://www.cdc.gov/vhf/ebola/clinicians/emergency-services/patient-handoff.html
15 | The National Emerging Special Pathogens Training and Education Center (NETEC) | netec.org
�EMS biosafety: Identify, Isolate, Inform:
https://repository.netecweb.org/files/original/4e07db6e4f6caba74c3d2a461447bb24.pdf
Handoff Protocol Example:
https://repository.netecweb.org/files/original/ae752dc3510f6b0804fe746a752a6f58.pdf
Updated: 04/18/2023
16 | The National Emerging Special Pathogens Training and Education Center (NETEC) | netec.org
�
https://repository.netecweb.org/files/original/4809eb55906643bfad1ca6a90364849e.docx
ff45b8705f305c0220cfabcc7b647304
Dublin Core
The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.
Title
A name given to the resource
Develop
Description
An account of the resource
<h2><span>These files will help you <strong><em>develop</em></strong> your program and plans based on what you have discovered.</span></h2>
<p style="font-size:120%;">Find model protocols and procedures and more in-depth training resources. You can go to the <a href="/exhibits/show/leadership"><button>Leadership Toolbox</button></a> or the <a href="https://repository.netecweb.org/exhibits/show/specialpopulations"><button>Special Populations</button></a> section. You can also go to the <a href="https://repository.netecweb.org/exhibits/show/netec-education/justintime"><button> Just in Time Training</button></a> page, the <a href="https://repository.netecweb.org/exhibits/show/ppe101/ppe"><button> PPE</button></a> page, or the <a href="https://repository.netecweb.org/exhibits/show/ems/prehospital"><button>EMS</button></a> page. <span>Subscribe to the NETEC <a href="https://www.youtube.com/channel/UCDpHc1LkcEpiWR0q7ll5eZQ" target="_blank" rel="noreferrer noopener"><button>Youtube Channel</button></a> to get all new Skills videos!</span></p>
Checklist
Checklist for processes.
Dublin Core
The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.
Title
A name given to the resource
Health Care Facility Viral Hemorrhagic Fever (VHF) Preparedness Checklist
Creator
An entity primarily responsible for making the resource
NETEC
Subject
The topic of the resource
Emergency Management
Description
An account of the resource
<p>Viral Hemorrhagic Fevers (VHF) are a group of diseases caused by several families of viruses. The term VHF refers to an illness that can affect multiple organ systems and can be accompanied by fever, headache, vomiting, abdominal pain, diarrhea, and hemorrhage. VHFs addressed in this document include <strong>Crimean-Congo Hemorrhagic Fever (CCHF)</strong>, <strong>Ebola Virus Disease (EVD)</strong>, <strong>Lassa Fever</strong>, and <strong>Marburg Virus Disease (MVD)</strong>.<br /><br />All health care facilities are part of the frontline defense against the spread of disease, as patients will seek care in emergency departments, urgent care centers and clinics. Health care facility preparedness to care for patients with a VHF is essential to prevent transmission to staff, other patients, and our communities.<br /><br />NETEC developed the Health Care Facility Viral Hemorrhagic Fever Preparedness Checklist to help health care facilities assess their readiness to identify, isolate, inform, and provide initial treatment for patients suspected or confirmed to have a VHF. This checklist is intended to guide facilities through a review of their immediate care capabilities and provide resources to assist in the resolution of preparedness gaps it reveals.</p>
<p><strong>Subscribe to the NETEC e-newsletter highlighting courses and training events, educational resources and information, and research news. <a target="_blank" href="https://netec.org/newsletter-sign-up/" rel="noreferrer noopener">Subscribe here.</a></strong></p>
Date
A point or period of time associated with an event in the lifecycle of the resource
2023-04-18
Coverage
The spatial or temporal topic of the resource, the spatial applicability of the resource, or the jurisdiction under which the resource is relevant
2024-04-18
Contributor
An entity responsible for making contributions to the resource
Not yet reviewed new - IPC
Checklist
Crimean Congo Haemorrhagic Fever (CCHF)
Ebola
Identify
Inform
Isolate
Lassa
Marburg
Personal Protective Equipment (PPE)
Preparedness
R-EM
R-IPC
South American Hemorrhagic Fever
Special Pathogens
Treatment and Care
Viral Hemorrhagic Fever
Waste Management
-
https://repository.netecweb.org/files/original/be2468ba6fe788de18016ef2e6bc4445.png
c80785ca1617e6b4e38f14491627e560
https://repository.netecweb.org/files/original/c367fe2e20068bf02ac4a0471591bbff.docx
9fb6f6905a90e8de6661ebe0dd787d93
Dublin Core
The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.
Title
A name given to the resource
Develop
Description
An account of the resource
<h2><span>These files will help you <strong><em>develop</em></strong> your program and plans based on what you have discovered.</span></h2>
<p style="font-size:120%;">Find model protocols and procedures and more in-depth training resources. You can go to the <a href="/exhibits/show/leadership"><button>Leadership Toolbox</button></a> or the <a href="https://repository.netecweb.org/exhibits/show/specialpopulations"><button>Special Populations</button></a> section. You can also go to the <a href="https://repository.netecweb.org/exhibits/show/netec-education/justintime"><button> Just in Time Training</button></a> page, the <a href="https://repository.netecweb.org/exhibits/show/ppe101/ppe"><button> PPE</button></a> page, or the <a href="https://repository.netecweb.org/exhibits/show/ems/prehospital"><button>EMS</button></a> page. <span>Subscribe to the NETEC <a href="https://www.youtube.com/channel/UCDpHc1LkcEpiWR0q7ll5eZQ" target="_blank" rel="noreferrer noopener"><button>Youtube Channel</button></a> to get all new Skills videos!</span></p>
Guide
Document providing operation or response information, general guidance documents.
Dublin Core
The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.
Title
A name given to the resource
Considerations for Terminal Cleaning and Decontamination of Special Pathogen Patient Care Rooms
Subject
The topic of the resource
Infection Control
Description
An account of the resource
Purpose: The information in this document includes general considerations that may be incorporated into terminal cleaning plans. It is intended to serve as a planning tool and resource for risk assessments or preparedness activities.
Creator
An entity primarily responsible for making the resource
NETEC
Source
A related resource from which the described resource is derived
The Infection Prevention and Control Work Group
Date
A point or period of time associated with an event in the lifecycle of the resource
2023-04-17
Coverage
The spatial or temporal topic of the resource, the spatial applicability of the resource, or the jurisdiction under which the resource is relevant
2025-04-17
Relation
A related resource
Y<br />Y - D0.1IC/D0.2IC Qualtrics # 201, original # 1<br />Y - D0.1IC/D0.2IC Qualtrics # 202, original # 1a<br />Y - D0.1IC/D0.2IC Qualtrics # 203, original # 1b<br />
<table style="border-collapse:collapse;width:490.328px;">
<tbody>
<tr>
<td style="width:44.1562px;white-space:normal;height:39px;background-color:transparent;border:1px solid #ababab;"><b>POS</b></td>
<td style="width:63.1484px;height:39px;white-space:normal;background-color:transparent;border:1px solid #ababab;"><b>DOMAIN</b></td>
<td style="width:76.9922px;white-space:normal;height:39px;background-color:transparent;border:1px solid #ababab;"><b>Original Question #</b></td>
<td style="width:73.0312px;white-space:normal;height:39px;background-color:transparent;border:1px solid #ababab;"><b>Qualtrics #</b></td>
<td style="width:232px;white-space:normal;height:39px;background-color:transparent;border:1px solid #ababab;"><b>Asset Link</b></td>
</tr>
<tr>
<td style="width:44.1562px;height:25.7891px;white-space:normal;background-color:transparent;border:1px solid #ababab;">45</td>
<td style="width:63.1484px;white-space:normal;background-color:transparent;border:1px solid #ababab;">2</td>
<td style="width:76.9922px;white-space:normal;background-color:transparent;border:1px solid #ababab;">1</td>
<td style="width:73.0312px;white-space:normal;background-color:transparent;border:1px solid #ababab;">201</td>
<td style="width:232px;white-space:normal;background-color:transparent;border:1px solid #ababab;">Considerations for Terminal Cleaning</td>
</tr>
<tr>
<td style="width:44.1562px;height:21.9609px;white-space:normal;background-color:transparent;border:1px solid #ababab;">46</td>
<td style="width:63.1484px;height:21.9609px;white-space:normal;background-color:transparent;border:1px solid #ababab;">2</td>
<td style="width:76.9922px;height:21.9609px;white-space:normal;background-color:transparent;border:1px solid #ababab;">1a</td>
<td style="width:73.0312px;height:21.9609px;white-space:normal;background-color:transparent;border:1px solid #ababab;">202</td>
<td style="width:232px;height:21.9609px;white-space:normal;background-color:transparent;border:1px solid #ababab;"><span class="x_ContentPasted1" style="background-color:#ffffff;">Considerations for Terminal Cleaning</span></td>
</tr>
<tr>
<td style="width:44.1562px;height:21.9609px;white-space:normal;background-color:transparent;border:1px solid #ababab;">47</td>
<td style="width:63.1484px;height:21.9609px;white-space:normal;background-color:transparent;border:1px solid #ababab;">2</td>
<td style="width:76.9922px;height:21.9609px;white-space:normal;background-color:transparent;border:1px solid #ababab;">1b</td>
<td style="width:73.0312px;height:21.9609px;white-space:normal;background-color:transparent;border:1px solid #ababab;">203</td>
<td style="width:232px;height:21.9609px;white-space:normal;background-color:transparent;border:1px solid #ababab;"><span class="x_ContentPasted2" style="background-color:#ffffff;">Considerations for Terminal Cleaning</span></td>
</tr>
</tbody>
</table>
<table style="border-collapse:collapse;width:490.328px;">
<tbody>
<tr>
<td style="width:44.1562px;height:21.9609px;white-space:normal;background-color:transparent;border:1px solid #ababab;">56</td>
<td style="width:63.1484px;white-space:normal;height:21.9609px;background-color:transparent;border:1px solid #ababab;">2</td>
<td style="width:76.9922px;height:21.9609px;white-space:normal;background-color:transparent;border:1px solid #ababab;">6</td>
<td style="width:73.0312px;white-space:normal;height:21.9609px;background-color:transparent;border:1px solid #ababab;">211</td>
<td style="width:232px;height:21.9609px;white-space:normal;border:1px solid #ababab;"><span class="x_ContentPasted3" style="margin:0px;background-color:#ffffff;">Considerations for Terminal Cleaning</span></td>
</tr>
<tr>
<td style="width:44.1562px;height:21.9609px;white-space:normal;background-color:transparent;border:1px solid #ababab;">58</td>
<td style="width:63.1484px;white-space:normal;height:21.9609px;background-color:transparent;border:1px solid #ababab;">2</td>
<td style="width:76.9922px;height:21.9609px;white-space:normal;background-color:transparent;border:1px solid #ababab;">6a</td>
<td style="width:73.0312px;white-space:normal;height:21.9609px;background-color:transparent;border:1px solid #ababab;">212</td>
<td style="width:232px;height:21.9609px;white-space:normal;border:1px solid #ababab;"><span class="x_ContentPasted3" style="margin:0px;background-color:#ffffff;">Considerations for Terminal Cleaning</span></td>
</tr>
<tr>
<td style="width:44.1562px;height:21.9609px;white-space:normal;background-color:transparent;border:1px solid #ababab;">61</td>
<td style="width:63.1484px;white-space:normal;height:21.9609px;background-color:transparent;border:1px solid #ababab;">2</td>
<td style="width:76.9922px;height:21.9609px;white-space:normal;background-color:transparent;border:1px solid #ababab;">8</td>
<td style="width:73.0312px;white-space:normal;height:21.9609px;background-color:transparent;border:1px solid #ababab;">215</td>
<td style="width:232px;height:21.9609px;white-space:normal;border:1px solid #ababab;">Considerations for Terminal Cleaning</td>
</tr>
<tr>
<td style="width:44.1562px;height:21.9609px;white-space:normal;background-color:transparent;border:1px solid #ababab;">62</td>
<td style="width:63.1484px;white-space:normal;height:21.9609px;background-color:transparent;border:1px solid #ababab;">2</td>
<td style="width:76.9922px;white-space:normal;height:21.9609px;background-color:transparent;border:1px solid #ababab;">8a</td>
<td style="width:73.0312px;white-space:normal;height:21.9609px;background-color:transparent;border:1px solid #ababab;">216</td>
<td style="width:232px;height:21.9609px;white-space:normal;border:1px solid #ababab;">Considerations for Terminal Cleaning</td>
</tr>
<tr>
<td style="width:44.1562px;height:21.9609px;white-space:normal;background-color:transparent;border:1px solid #ababab;">64</td>
<td style="width:63.1484px;height:21.9609px;white-space:normal;background-color:transparent;border:1px solid #ababab;">2</td>
<td style="width:76.9922px;height:21.9609px;white-space:normal;background-color:transparent;border:1px solid #ababab;">9</td>
<td style="width:73.0312px;height:21.9609px;white-space:normal;background-color:transparent;border:1px solid #ababab;">218</td>
<td style="width:232px;height:21.9609px;white-space:normal;background-color:transparent;border:1px solid #ababab;">Considerations for Terminal Cleaning</td>
</tr>
<tr>
<td style="width:44.1562px;height:23.0078px;white-space:normal;background-color:transparent;border:1px solid #ababab;">66</td>
<td style="width:63.1484px;white-space:normal;height:23.0078px;background-color:transparent;border:1px solid #ababab;">2</td>
<td style="width:76.9922px;white-space:normal;height:23.0078px;background-color:transparent;border:1px solid #ababab;">9b</td>
<td style="width:73.0312px;white-space:normal;height:23.0078px;background-color:transparent;border:1px solid #ababab;">220</td>
<td style="width:232px;height:23.0078px;white-space:normal;background-color:transparent;border:1px solid #ababab;">Considerations for Terminal Cleaning</td>
</tr>
<tr>
<td style="width:44.1562px;height:21.9609px;white-space:normal;background-color:transparent;border:1px solid #ababab;">67</td>
<td style="width:63.1484px;height:21.9609px;white-space:normal;background-color:transparent;border:1px solid #ababab;">2</td>
<td style="width:76.9922px;height:21.9609px;white-space:normal;background-color:transparent;border:1px solid #ababab;">9c</td>
<td style="width:73.0312px;height:21.9609px;white-space:normal;background-color:transparent;border:1px solid #ababab;">221</td>
<td style="width:232px;height:21.9609px;white-space:normal;background-color:transparent;border:1px solid #ababab;"><span class="x_ContentPasted5" style="background-color:#ffffff;">Considerations for Terminal Cleaning</span></td>
</tr>
<tr>
<td style="width:44.1562px;height:21.9609px;white-space:normal;background-color:transparent;border:1px solid #ababab;">68</td>
<td style="width:63.1484px;height:21.9609px;white-space:normal;background-color:transparent;border:1px solid #ababab;">2</td>
<td style="width:76.9922px;height:21.9609px;white-space:normal;background-color:transparent;border:1px solid #ababab;">10</td>
<td style="width:73.0312px;height:21.9609px;white-space:normal;background-color:transparent;border:1px solid #ababab;">222</td>
<td style="width:232px;height:21.9609px;white-space:normal;background-color:transparent;border:1px solid #ababab;"><span class="x_ContentPasted6" style="background-color:#ffffff;">Considerations for Terminal Cleaning</span></td>
</tr>
<tr>
<td style="width:44.1562px;height:21.9609px;white-space:normal;background-color:transparent;border:1px solid #ababab;">69</td>
<td style="width:63.1484px;height:21.9609px;white-space:normal;background-color:transparent;border:1px solid #ababab;">2</td>
<td style="width:76.9922px;height:21.9609px;white-space:normal;background-color:transparent;border:1px solid #ababab;">11</td>
<td style="width:73.0312px;height:21.9609px;white-space:normal;background-color:transparent;border:1px solid #ababab;">223</td>
<td style="width:232px;height:21.9609px;white-space:normal;background-color:transparent;border:1px solid #ababab;"><span class="x_ContentPasted7" style="background-color:#ffffff;">Considerations for Terminal Cleaning</span></td>
</tr>
<tr>
<td style="width:44.1562px;height:21.9609px;white-space:normal;background-color:transparent;border:1px solid #ababab;">72</td>
<td style="width:63.1484px;height:21.9609px;white-space:normal;background-color:transparent;border:1px solid #ababab;">2</td>
<td style="width:76.9922px;height:21.9609px;white-space:normal;background-color:transparent;border:1px solid #ababab;">13</td>
<td style="width:73.0312px;height:21.9609px;white-space:normal;background-color:transparent;border:1px solid #ababab;">226</td>
<td style="width:232px;height:21.9609px;white-space:normal;background-color:transparent;border:1px solid #ababab;"><span class="x_ContentPasted8" style="background-color:#ffffff;">Considerations for Terminal Cleaning</span></td>
</tr>
<tr>
<td style="width:44.1562px;height:21.9609px;white-space:normal;background-color:transparent;border:1px solid #ababab;">73</td>
<td style="width:63.1484px;height:21.9609px;white-space:normal;background-color:transparent;border:1px solid #ababab;">2</td>
<td style="width:76.9922px;height:21.9609px;white-space:normal;background-color:transparent;border:1px solid #ababab;">14</td>
<td style="width:73.0312px;height:21.9609px;white-space:normal;background-color:transparent;border:1px solid #ababab;">227</td>
<td style="width:232px;height:21.9609px;white-space:normal;background-color:transparent;border:1px solid #ababab;"><span class="x_ContentPasted9" style="background-color:#ffffff;">Considerations for Terminal Cleaning</span></td>
</tr>
<tr>
<td style="width:44.1562px;height:21.9609px;white-space:normal;background-color:transparent;border:1px solid #ababab;">74</td>
<td style="width:63.1484px;height:21.9609px;white-space:normal;background-color:transparent;border:1px solid #ababab;">2</td>
<td style="width:76.9922px;height:21.9609px;white-space:normal;background-color:transparent;border:1px solid #ababab;">15</td>
<td style="width:73.0312px;height:21.9609px;white-space:normal;background-color:transparent;border:1px solid #ababab;">228</td>
<td style="width:232px;height:21.9609px;white-space:normal;background-color:transparent;border:1px solid #ababab;"><span class="x_ContentPasted10" style="background-color:#ffffff;">Considerations for Terminal Cleaning</span></td>
</tr>
<tr>
<td style="width:44.1562px;height:21.9609px;white-space:normal;background-color:transparent;border:1px solid #ababab;">75</td>
<td style="width:63.1484px;height:21.9609px;white-space:normal;background-color:transparent;border:1px solid #ababab;">2</td>
<td style="width:76.9922px;height:21.9609px;white-space:normal;background-color:transparent;border:1px solid #ababab;">16</td>
<td style="width:73.0312px;height:21.9609px;white-space:normal;background-color:transparent;border:1px solid #ababab;">229</td>
<td style="width:232px;height:21.9609px;white-space:normal;background-color:transparent;border:1px solid #ababab;"><span class="x_ContentPasted11" style="background-color:#ffffff;">Considerations for Terminal Cleaning</span></td>
</tr>
<tr>
<td style="width:44.1562px;height:22.0391px;white-space:normal;background-color:transparent;border:1px solid #ababab;">76</td>
<td style="width:63.1484px;height:22.0391px;white-space:normal;background-color:transparent;border:1px solid #ababab;">2</td>
<td style="width:76.9922px;height:22.0391px;white-space:normal;background-color:transparent;border:1px solid #ababab;">17</td>
<td style="width:73.0312px;height:22.0391px;white-space:normal;background-color:transparent;border:1px solid #ababab;">230</td>
<td style="width:232px;height:22.0391px;white-space:normal;background-color:transparent;border:1px solid #ababab;"><span class="x_ContentPasted12" style="background-color:#ffffff;">Considerations for Terminal Cleaning</span></td>
</tr>
</tbody>
</table>
Cleaning
Crimean Congo Haemorrhagic Fever (CCHF)
Decontamination
Disinfection
Ebola
High Consequence Infectious Disease (HCID)
Identify
Infection Prevention and Control
Lassa
Marburg
Personal Protective Equipment (PPE)
R-IPC
Special Pathogens
Terminal Clean
Viral Hemorrhagic Fever
-
https://repository.netecweb.org/files/original/d08bdb34d9d582e685c43b2b9812e496.png
1b6b01a22c0ec5517f95feb53db57c40
Dublin Core
The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.
Title
A name given to the resource
Discover
Description
An account of the resource
<div style="background-color:#c7e5f8;">
<h2 style="background-color:#c7e5f8;"><span style="font-size:80%;line-height:24px;"><a href="https://repository.netecweb.org/exhibits/show/ncov/ncov"><button>COVID-19 Update</button></a><a href="https://repository.netecweb.org/news#Map"><button>Outbreak Map</button></a><a href="https://repository.netecweb.org/news#News"><button>Newsfeed</button></a><a href="https://repository.netecweb.org/exhibits/show/monkeypox/monkeypox"><button>Monkeypox 2021</button></a><a href="https://repository.netecweb.org/exhibits/show/drcebola2018/drcebola2018"><button>2020 Ebola Update</button></a><a href="https://repository.netecweb.org/ebolatimeline"><button>Ebola Timeline</button></a><a href="https://repository.netecweb.org/exhibits/show/mers/mers"><button>MERS</button></a><a href="https://repository.netecweb.org/exhibits/show/aerosol/aerosol"><button>Airborne Transmission</button></a></span></h2>
<h2 style="background-color:#c7e5f8;">Discover Background Data and Resources:</h2>
<ul><li>
<p><span style="line-height:24px;">Get introduced to NETEC through the interactive timeline of special pathogens below.* This timeline describes some significant special pathogen events in recent history.</span></p>
</li>
<li>
<p><span style="line-height:24px;">Find out more about the 2014 Ebola outbreak and the development of the ASPR/CDC-supported network of healthcare facilities preparing for the next outbreak through <em><a href="/ebolatimeline"><button>the Ebola timeline</button></a>.</em></span></p>
</li>
</ul><ul><li>
<p><span style="line-height:24px;">This NETEC Repository helps to provide training and educational resources to prepare for future special pathogen events. </span></p>
</li>
</ul><ul><li>
<p><span style="line-height:24px;">Explore the files BELOW THE TIMELINE to <em><strong>discover and learn</strong></em> more about Ebola and other Special Pathogens, an overview of special pathogens, clinically managing patients affected, and readying healthcare teams and systems to keep everyone safe.</span></p>
</li>
</ul><h2 style="background-color:#c7e5f8;">Timeline of Special Pathogens:</h2>
<a href="#click">Skip timeline</a>
<p style="margin-bottom:0;"><iframe width="100%" height="635" style="border:1px solid #000000;" src="https://cdn.knightlab.com/libs/timeline3/latest/embed/index.html?source=1AQiHJEzkhEi71uIi7wTWWgSFRwR6wRbRyfhbASrw3Ig&font=Default&lang=en&initial_zoom=2&height=650" title="Timeline of Special Pathogens"></iframe></p>
<h2 style="background-color:#c7e5f8;"><span style="font-size:70%;">*Click for <a href="/timeline2access"><button>a screen reader accessible table of this timeline</button></a>. </span></h2>
</div>
Hyperlink
A link, or reference, to another resource on the Internet.
URL
https://nextstrain.org/community/pauloluniyi/lassa/l
Dublin Core
The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.
Title
A name given to the resource
Nextstrain - Real-time tracking of Lassa virus evolution 2015-2018 Outbreak in Nigeria
Subject
The topic of the resource
General
Description
An account of the resource
Nextstrain is an open-source project to harness the scientific and public health potential of pathogen genome data. It provides a continually-updated view of publicly available data alongside powerful analytic and visualization tools for use by the community. The goal is to aid epidemiological understanding and improve outbreak response. <iframe width="100%" height="500" title="Nextstrain Lassa" src="https://nextstrain.org/community/pauloluniyi/lassa/l"></iframe>
Creator
An entity primarily responsible for making the resource
Nextstrain
Source
A related resource from which the described resource is derived
Built with <a href="https://github.com/pauloluniyi/lassa" target="_blank" class="byline__BylineLink-sc-wamdqn-1 MujGV" rel="noreferrer noopener">pauloluniyi/lassa</a>. Maintained by Paul Oluniyi, ACEGID Redeemer's University.
Date
A point or period of time associated with an event in the lifecycle of the resource
2018-08-07
Lassa
Outbreaks
R-Res&Pub
Viral Hemorrhagic Fever
Virology
-
https://repository.netecweb.org/files/original/3ecdf9ad2e895e821befc962f42404aa.png
296085ee4a3f7749edcca5dd219d210f
Dublin Core
The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.
Title
A name given to the resource
Discover
Description
An account of the resource
<div style="background-color:#c7e5f8;">
<h2 style="background-color:#c7e5f8;"><span style="font-size:80%;line-height:24px;"><a href="https://repository.netecweb.org/exhibits/show/ncov/ncov"><button>COVID-19 Update</button></a><a href="https://repository.netecweb.org/news#Map"><button>Outbreak Map</button></a><a href="https://repository.netecweb.org/news#News"><button>Newsfeed</button></a><a href="https://repository.netecweb.org/exhibits/show/monkeypox/monkeypox"><button>Monkeypox 2021</button></a><a href="https://repository.netecweb.org/exhibits/show/drcebola2018/drcebola2018"><button>2020 Ebola Update</button></a><a href="https://repository.netecweb.org/ebolatimeline"><button>Ebola Timeline</button></a><a href="https://repository.netecweb.org/exhibits/show/mers/mers"><button>MERS</button></a><a href="https://repository.netecweb.org/exhibits/show/aerosol/aerosol"><button>Airborne Transmission</button></a></span></h2>
<h2 style="background-color:#c7e5f8;">Discover Background Data and Resources:</h2>
<ul><li>
<p><span style="line-height:24px;">Get introduced to NETEC through the interactive timeline of special pathogens below.* This timeline describes some significant special pathogen events in recent history.</span></p>
</li>
<li>
<p><span style="line-height:24px;">Find out more about the 2014 Ebola outbreak and the development of the ASPR/CDC-supported network of healthcare facilities preparing for the next outbreak through <em><a href="/ebolatimeline"><button>the Ebola timeline</button></a>.</em></span></p>
</li>
</ul><ul><li>
<p><span style="line-height:24px;">This NETEC Repository helps to provide training and educational resources to prepare for future special pathogen events. </span></p>
</li>
</ul><ul><li>
<p><span style="line-height:24px;">Explore the files BELOW THE TIMELINE to <em><strong>discover and learn</strong></em> more about Ebola and other Special Pathogens, an overview of special pathogens, clinically managing patients affected, and readying healthcare teams and systems to keep everyone safe.</span></p>
</li>
</ul><h2 style="background-color:#c7e5f8;">Timeline of Special Pathogens:</h2>
<a href="#click">Skip timeline</a>
<p style="margin-bottom:0;"><iframe width="100%" height="635" style="border:1px solid #000000;" src="https://cdn.knightlab.com/libs/timeline3/latest/embed/index.html?source=1AQiHJEzkhEi71uIi7wTWWgSFRwR6wRbRyfhbASrw3Ig&font=Default&lang=en&initial_zoom=2&height=650" title="Timeline of Special Pathogens"></iframe></p>
<h2 style="background-color:#c7e5f8;"><span style="font-size:70%;">*Click for <a href="/timeline2access"><button>a screen reader accessible table of this timeline</button></a>. </span></h2>
</div>
Video
A video iframed into the item.
Player
Field for the html for a video player.
<iframe width="560" height="315" src="https://www.youtube.com/embed/Zzy-BCMCed8" frameborder="0" title="Antibodies against Ebola Video"></iframe>
URL
https://www.youtube.com/watch?v=Zzy-BCMCed8
Dublin Core
The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.
Title
A name given to the resource
Antibodies Against Ebola and Lassa
Subject
The topic of the resource
Research
Description
An account of the resource
The 2017 Kinyoun Lecture discusses antibodies protecting against Ebola and Lassa, and the need for research collaboration.
Creator
An entity primarily responsible for making the resource
NIH
Date
A point or period of time associated with an event in the lifecycle of the resource
2017-12-05
Antibodies
Ebola
Immunology
Lassa
R-Res&Pub
Vaccine Study
Viral Hemorrhagic Fever
Virology
-
https://repository.netecweb.org/files/original/2d96838a144eb3974e7dc8ea2e26ec3a.pdf
8cea1a49df7772b249c54d5f115829f3
PDF Text
Text
Special Pathogens Response Matrix
*Guidance is subject to change as additional information becomes available*
If a Special Pathogens case is suspected, immediately notify: Infection Prevention and Control, department leadership, NYC DOHMH Provider Access Line: 866-692-3641.
If patient is determined to be a PUI after consultation with DOHMH, notify Central Office Special Pathogens Program: 646-684-5442.
Disease
Crimean-Congo Hemorrhagic Fever
Ebola Virus Disease
Lassa; Lujo; Machupo; Junin
Hemorrhagic Fevers
Initial
Signs/Symptoms
Incubation
Period
Patient
Placement
Transmissionbased
Precautions
Airborne Infection
Standard, Contact,
Isolation Room (AIIR) or Airborne
private room with a
dedicated bathroom or
bedside commode if
AIIR is
unavailable.
Duration of illness
Fever, abdominal pain,
2-21 days
vomiting, diarrhea,
general malaise and
weakness, and headache,
fatigue, unexplained
hemorrhage
Airborne Infection
Standard, Contact,
Isolation Room (AIIR) or Airborne
private room with a
dedicated bathroom or
bedside commode if
AIIR is
unavailable.
Duration of illness
Fever, myalgia,
abdominal pain,
vomiting, diarrhea,
malaise, headache,
unexplained hemorrhage.
Lujo- morbilliform rash
on face/trunk
Lassa: 2-21 days
Lujo: 7-13 days
Machupo: 3-16
days
Airborne Infection
Standard, Contact,
Isolation Room (AIIR) or Airborne
private room with a
dedicated bathroom or
bedside commode if
AIIR is
unavailable.
Duration of illness
Fever, chills, headache,
and myalgia
2-21 days
Airborne Infection
Standard, Contact,
Isolation Room (AIIR) or Airborne
private room with a
dedicated bathroom or
bedside commode if
AIIR is
unavailable.
Duration of illness
Fever, headache, fatigue, 2-7days
myalgia
Airborne Infection
Isolation Room (AIIR)
Standard, Contact,
Airborne
Duration of illness plus
10 days after resolution
of fever, provided
respiratory symptoms
are absent or improving
Fever, cough, shortness
of breath
2-14 days
Airborne Infection
Isolation Room (AIIR)
Standard, Contact,
Airborne
Duration of precautions Use Special Pathogens Level 1 PPE:
should be determined
Gown, gloves, N-95 respirator, eye
on a case-by-case basis, protection.
in conjunction with local
and state authorities.
Fever, headache,
drowsiness, respiratory
illness, disorientation,
confusion, encephalitis
5-14 days
Airborne Infection
Isolation Room (AIIR)
Standard, Contact,
Airborne
Duration of illess
(limited data)
Fever, headache,
weakness, rapidly
developing pneumonia,
chest pain, shortness of
breath
2-6 days
Private room with a
dedicated bathroom.
Standard, Droplet
Fever, chills, myalgia,
cough, shortness of
breath, fatigue
1-4 days
Airborne Infection
Isolation Room (AIIR)
fever, head and body
aches, vomiting, rash
7-19 days
Private room with a
dedicated bathroom.
Use Special Pathogens Level 2 VHF: N95
respirator, 2 pairs of extended cuff
gloves, coverall or gown, apron, face
shield, hood, knee high boot covers, shoe
covers (if coverall used).
Consult with NYC DOHMH.
Avoid performing routine laboratory testing unless essential for
patient care. Specimens should be labeled to indicate that they have
originated from a suspected patient and double-bagged, placed in a
biohazard transportation container, and hand-carried to the
laboratory.
If available, use dedicated Point-of-Care instruments and methods
inside or nearby the patient’s isolation room.
Maintain a log of personnel handling specimens.
Use Special Pathogens Level 2 VHF: N95 Consult with NYC DOHMH.
respirator, 2 pairs of extended cuff
Avoid performing routine laboratory testing unless essential for
gloves, coverall or gown, apron, face
patient care. Specimens should be labeled to indicate that they have
shield, hood, knee high boot covers, shoe originated from a suspected patient and double-bagged, placed in a
covers (if coverall used).
biohazard transportation container, and hand-carried to the
laboratory.
If available, use dedicated Point-of-Care instruments and methods
inside or nearby the patient’s isolation room.
Maintain a log of personnel handling specimens.
Use Special Pathogens Level 2 VHF: N95 Consult with NYC DOHMH.
respirator, 2 pairs of extended cuff
Avoid performing routine laboratory testing unless essential for
gloves, coverall or gown, apron, face
patient care. Specimens should be labeled to indicate that they have
shield, hood, knee high boot covers, shoe originated from a suspected patient and double-bagged, placed in a
covers (if coverall used).
biohazard transportation container, and hand-carried to the
laboratory.
If available, use dedicated Point-of-Care instruments and methods
inside or nearby the patient’s isolation room.
Maintain a log of personnel handling specimens.
Use Special Pathogens Level 2 VHF: N95 Consult with NYC DOHMH.
respirator, 2 pairs of extended cuff
Avoid performing routine laboratory testing unless essential for
gloves, coverall or gown, apron, face
patient care. Specimens should be labeled to indicate that they have
shield, hood, knee high boot covers, shoe originated from a suspected patient and double-bagged, placed in a
covers (if coverall used).
biohazard transportation container, and hand-carried to the
laboratory.
If available, use dedicated Point-of-Care instruments and methods
inside or nearby the patient’s isolation room.
Maintain a log of personnel handling specimens.
Use Special Pathogens Level 1 PPE:
Consult with NYC DOHMH.
Gown, gloves, N-95 respirator, eye
Avoid performing diagnostic tests unless notified with guidance from
protection.
public health department.
Packaging & Shipping of Specimen for Diagnostic
Testing
Visitor Management
Waste Management
Transfer to
Bellevue
Hospital
Activation of
Hospital
Incident
Command
System
Avoid entry of visitors into the
patient’s room. Exceptions may be
considered on a case by case basis
for those who are essential for the
patient’s wellbeing.
Category A: All cleaning, disinfection, and transport of waste will be
escalated to and managed by vendors with expertise in handling Category
A waste. Once the patient vacates a room, all unprotected individuals,
including HCP, should not be allowed in that room until sufficient time
has elapsed for enough air changes to remove potentially infectious
particles and the room has been cleaned and disinfected by designated
vendor.
Yes. Decision to
Yes
transfer patient(s)
will be made in
consultation with
NYC DOHMH and
NYS DOH.
Follow basic triple packaging system which consists of a primary
container (a sealable specimen container) wrapped with absorbent
material, secondary container (watertight, leak-proof), and an outer
shipping package. Must be packaged by laboratory staff who are
certified in packaging/shipment of infectious substances.
Avoid entry of visitors into the
patient’s room. Exceptions may be
considered on a case by case basis
for those who are essential for the
patient’s wellbeing.
Category A: All cleaning, disinfection, and transport of waste will be
escalated to and managed by vendors with expertise in handling Category
A waste. Once the patient vacates a room, all unprotected individuals,
including HCP, should not be allowed in that room until sufficient time
has elapsed for enough air changes to remove potentially infectious
particles and the room has been cleaned and disinfected by designated
vendor.
Yes. Decision to
Yes
transfer patient(s)
will be made in
consultation with
NYC DOHMH and
NYS DOH.
Follow basic triple packaging system which consists of a primary
container (a sealable specimen container) wrapped with absorbent
material, secondary container (watertight, leak-proof), and an outer
shipping package. Must be packaged by laboratory staff who are
certified in packaging/shipment of infectious substances.
Avoid entry of visitors into the
patient’s room. Exceptions may be
considered on a case by case basis
for those who are essential for the
patient’s wellbeing.
Category A: All cleaning, disinfection, and transport of waste will be
escalated to and managed by vendors with expertise in handling Category
A waste. Once the patient vacates a room, all unprotected individuals,
including HCP, should not be allowed in that room until sufficient time
has elapsed for enough air changes to remove potentially infectious
particles and the room has been cleaned and disinfected by designated
vendor.
Yes. Decision to
Yes
transfer patient(s)
will be made in
consultation with
NYC DOHMH and
NYS DOH.
Follow basic triple packaging system which consists of a primary
container (a sealable specimen container) wrapped with absorbent
material, secondary container (watertight, leak-proof), and an outer
shipping package. Must be packaged by laboratory staff who are
certified in packaging/shipment of infectious substances.
Avoid entry of visitors into the
patient’s room. Exceptions may be
considered on a case by case basis
for those who are essential for the
patient’s wellbeing.
Category A: All cleaning, disinfection, and transport of waste will be
escalated to and managed by vendors with expertise in handling Category
A waste. Once the patient vacates a room, all unprotected individuals,
including HCP, should not be allowed in that room until sufficient time
has elapsed for enough air changes to remove potentially infectious
particles and the room has been cleaned and disinfected by designated
vendor.
Yes. Decision to
Yes
transfer patient(s)
will be made in
consultation with
NYC DOHMH and
NYS DOH.
Follow basic triple packaging system which consists of a primary
container (a sealable specimen container) wrapped with absorbent
material, secondary container (watertight, leak-proof), and an outer
shipping package. Must be packaged by laboratory staff who are
certified in packaging/shipment of infectious substances.
Avoid entry of visitors into the
patient’s room. Exceptions may be
considered on a case by case basis
for those who are essential for the
patient’s wellbeing.
Category B: All cleaning, disinfection, and transport of waste will be
escalated to and managed by facility EVS and designated vendors with
expertise in handling Category B waste. Once the patient vacates a room,
all unprotected individuals, including HCP, should not be allowed in that
room until sufficient time has elapsed for enough air changes to remove
potentially infectious particles and the room has been cleaned and
disinfected by facility EVS.
Case-by-case
Yes
basis. Decision to
transfer patient(s)
will be made in
consultation with
NYC DOHMH and
NYS DOH.
Consult NYC DOHMH.
Clinical laboratories performing routine diagnostic tests on serum,
blood, or urine specimens should follow standard laboratory practices,
including Standard Precautions, when handling potential MERS-CoV
specimens. Laboratory workers should wear PPE (gloves, gown,
respirator, and eye protection) when handling potentially infectious
specimens and decontaminate work surfaces and equipment with
appropriate disinfectants.
Follow basic triple packaging system which consists of a primary
container (a sealable specimen container) wrapped with absorbent
material, secondary container (watertight, leak-proof), and an outer
shipping package. Must be packaged by laboratory staff who are
certified in packaging/shipment of infectious substances.
Avoid entry of visitors into the
patient’s room. Exceptions may be
considered on a case by case basis
for those who are essential for the
patient’s wellbeing.
Category B: All cleaning, disinfection, and transport of waste will be
escalated to and managed by facility EVS and designated vendors with
expertise in handling Category B waste. Once the patient vacates a room,
all unprotected individuals, including HCP, should not be allowed in that
room until sufficient time has elapsed for enough air changes to remove
potentially infectious particles and the room has been cleaned and
disinfected by facility EVS.
Case-by-case
Yes
basis. Decision to
transfer patient(s)
will be made in
consultation with
NYC DOHMH and
NYS DOH.
Use Special Pathogens Level 1 PPE:
Gown, gloves, N-95 respirator, eye
protection.
Consult NYC DOHMH.
Avoid performing diagnostic tests or invasive procedures.
Avoid sending specimens to clinical laboratory unless notified with
guidance from public health department.
Consult NYC DOHMH.
Avoid entry of visitors into the
patient’s room. Exceptions may be
considered on a case by case basis
for those who are essential for the
patient’s wellbeing.
Category A: All cleaning, disinfection, and transport of waste will be
escalated to and managed by vendors with expertise in handling Category
A waste. Once the patient vacates a room, all unprotected individuals,
including HCP, should not be allowed in that room until sufficient time
has elapsed for enough air changes to remove potentially infectious
particles and the room has been cleaned and disinfected by designated
vendor.
Yes. Decision to
Yes
transfer patient(s)
will be made in
consultation with
NYC DOHMH and
NYS DOH.
Until 48 hours after
initiation of effective
antibiotic
Minimum PPE: face mask
Additional PPE may be used: Gown,
gloves, eye protection.
Consult NYC DOHMH.
Follow basic triple packaging system which consists of a primary
container (a sealable specimen container) wrapped with absorbent
material, secondary container (watertight, leak-proof), and an outer
shipping package. Must be packaged by laboratory staff who are
certified in packaging/shipment of infectious substances.
Avoid entry of visitors into the
patient’s room. Exceptions may be
considered on a case by case basis
for those who are essential for the
patient’s wellbeing.
Category B (Microbiology lab cultures only are Category A). All cleaning,
disinfection, and transport of waste will be escalated to and managed by
facility EVS and designated vendors with expertise in handling Category B
waste. Once the patient vacates a room, all unprotected individuals,
including HCP, should not be allowed in that room until sufficient time
has elapsed for enough air changes to remove potentially infectious
particles and the room has been cleaned and disinfected by facility EVS.
Case-by-case
Yes
basis. Decision to
transfer patient(s)
will be made in
consultation with
NYC DOHMH and
NYS DOH.
Standard, Contact,
Airborne
Duration of illness
Use Special Pathogens Level 1 PPE:
Gown, gloves, N-95 respirator, eye
protection.
Refer to: Interim Guidance on Testing and Specimen Collection for
Consult NYC DOHMH. Almost all FDA-cleared influenza diagnostic tests
Patients with Suspected Infection with Novel Influenza A Viruses
do not specifically identify infection with avian influenza A viruses or
with the Potential to Cause Severe Disease in Humans | Avian
distinguish between infection with seasonal influenza A or novel
Influenza: https://www.cdc.gov/flu/avianflu/severe-potential.htm
influenza A viruses. Although some diagnostic assays may detect the
presence of some novel influenza A viruses, a negative result should
not be used to rule out novel influenza A virus infection when testing
possible human cases. Testing of symptomatic human cases of
suspected novel influenza A virus infection should be referred to the
nearest public health laboratory based on clinical suspicion due to
exposure to birds.
Avoid entry of visitors into the
patient’s room. Exceptions may be
considered on a case by case basis
for those who are essential for the
patient’s wellbeing.
Category B: All cleaning, disinfection, and transport of waste will be
escalated to and managed by facility EVS and designated vendors with
expertise in handling Category B waste. Once the patient vacates a room,
all unprotected individuals, including HCP
Case-by-case
Yes
basis. Decision to
transfer patient(s)
will be made in
consultation with
NYC DOHMH and
NYS DOH.
Standard, Contact,
Airborne
Duration of illness
Use Special Pathogens Level 1 PPE:
Gown, gloves, N-95 respirator, eye
protection.
Consult NYC DOHMH.
Avoid entry of visitors into the
patient’s room. Exceptions may be
considered on a case by case basis
for those who are essential for the
patient’s wellbeing.
Category A: All cleaning, disinfection, and transport of waste will be
escalated to and managed by vendors with expertise in handling Category
A waste. Once the patient vacates a room, all unprotected individuals,
including HCP, should not be allowed in that room until sufficient time
has elapsed for enough air changes to remove potentially infectious
particles and the room has been cleaned and disinfected by designated
vendor.
Yes. Decision to
Yes
transfer patient(s)
will be made in
consultation with
NYC DOHMH and
NYS DOH.
Middle East Respiratory Syndrome
(MERS)
Novel influenza with pandemic potential
(e.g., H3N1, H7N9, H5N1)
Smallpox
Altered Clinical Lab Practices
Follow basic triple packaging system which consists of a primary
container (a sealable specimen container) wrapped with absorbent
material, secondary container (watertight, leak-proof), and an outer
shipping package. Must be packaged by laboratory staff who are
certified in packaging/shipment of infectious substances.
Severe Acute Respiratory Syndrome
(SARS)
Plague (pneumonic)
PPE
Fever, headache, back
2-14 days
pain, joint pain, stomach
pain, vomiting, red eyes,
flushed face, red throat,
petechiae (red spots) on
the palate
Marburg Hemorrhagic Fever
Nipah Virus
Duration of
Precuations
Follow basic triple packaging system which consists of a primary
container (a sealable specimen container) wrapped with absorbent
material, secondary container (watertight, leak-proof), and an outer
shipping package. Must be packaged by laboratory staff who are
certified in packaging/shipment of infectious substances.
�Fever, Headache, Muscle 5-21 days
aches, Backache, Swollen
lymph nodes, Chills,
Exhaustion, rash
Private room with a
dedicated bathroom.
Enhanced Droplet + Until lesions have
Use Special Pathogens Level 1 PPE:
Contact + Eye
crusted over and fresh Gown, gloves, N-95 respirator, eye
Protection
layer of skin has formed. protection.
--
--
Airborne Infection
Isolation Room (AIIR)
Standard
CATEGORY B: An
infectious substance not
in a form generally
capable of causing
permanent disability or
life-threatening or fatal
disease in otherwise
healthy humans or
animals when exposure
to it occurs. This includes
Category B infectious
substances transported
for diagnostic or
investigational purposes.
Regulated
Medical Waste
(RMW): or “Red
Bag” waste as it
is commonly
known,
is material
generated in
research,
production, and
testing of
biologicals or
health care,
such as
Infectious
animal waste.
Human
pathological
waste. Human
blood and blood
products.
Needles and
syringes (sharps)
No altered lab practices for routine labs. Standard precautions to
protect against potential infectious agents within any specimen
received (using BSL-2 containment) are recommended.
Follow basic triple packaging system which consists of a primary
container (a sealable specimen container) wrapped with absorbent
material, secondary container (watertight, leak-proof), and an outer
shipping package. Must be packaged by laboratory staff who are
certified in packaging/shipment of infectious substances.
Avoid entry of visitors into the
patient’s room. Exceptions may be
considered on a case by case basis
for those who are essential for the
patient’s wellbeing.
Clade II (formerly known as West African Clade):
No
Regulated Medical Waste: Managed the same way other waste from
healthcare facilities is routinely managed.
Clade I (formerly known as Congo Basin/Central African Clade):
Category A: All cleaning, disinfection, and transport of waste will be
escalated to and managed by vendors with expertise in handling Category
A waste. Once the patient vacates a room, all unprotected individuals,
including HCP, should not be allowed in that room until sufficient time
has elapsed for enough air changes to remove potentially infectious
particles and the room has been cleaned and disinfected by designated
vendor.
No
Consult NYC DOHMH.
Consult NYC DOHMH.
--
Yes
Mpox
Environmental Anthrax
(e.g. powder form)
CATEGORY A: An infectious substance in
a form capable of causing permanent
disability or life-threatening or fatal
disease in otherwise healthy humans or
animals when exposure to it occurs. An
exposure occurs when an infectious
substance is released outside of its
protective packaging, resulting in
physical contact with humans or animals.
Classification must be based on the
known medical history or symptoms of
the source patient or animal, endemic
local conditions, or professional
judgment concerning the individual
circumstances of the source human or
animal. Category A poses a higher degree
of risk than Category B.
Updated 12.15.2023
Until environment is
completely
decontaminated.
Wear respirator (N95 or PAPR) and
Consult NYC DOHMH.
protective clothing/eye protection;
decontaminate persons with powder on
them. Selection of specific PPE should be
based on an assessment of potential
exposures and activities; a higher level of
protection might be required per
recommendations from NYC DOHMH.
No
�
Dublin Core
The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.
Title
A name given to the resource
Develop
Description
An account of the resource
<h2><span>These files will help you <strong><em>develop</em></strong> your program and plans based on what you have discovered.</span></h2>
<p style="font-size:120%;">Find model protocols and procedures and more in-depth training resources. You can go to the <a href="/exhibits/show/leadership"><button>Leadership Toolbox</button></a> or the <a href="https://repository.netecweb.org/exhibits/show/specialpopulations"><button>Special Populations</button></a> section. You can also go to the <a href="https://repository.netecweb.org/exhibits/show/netec-education/justintime"><button> Just in Time Training</button></a> page, the <a href="https://repository.netecweb.org/exhibits/show/ppe101/ppe"><button> PPE</button></a> page, or the <a href="https://repository.netecweb.org/exhibits/show/ems/prehospital"><button>EMS</button></a> page. <span>Subscribe to the NETEC <a href="https://www.youtube.com/channel/UCDpHc1LkcEpiWR0q7ll5eZQ" target="_blank" rel="noreferrer noopener"><button>Youtube Channel</button></a> to get all new Skills videos!</span></p>
Guide
Document providing operation or response information, general guidance documents.
Dublin Core
The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.
Title
A name given to the resource
NYC Health + Hospitals Special Pathogens Response Matrix
Subject
The topic of the resource
Emergency Management
Description
An account of the resource
Matrix with response to different special pathogens.
Creator
An entity primarily responsible for making the resource
NYC Health + Hospitals
Date
A point or period of time associated with an event in the lifecycle of the resource
2023-12-15
Relation
A related resource
Y - D0.1EM/D0.2EM - Qualtrics # 505
Contributor
An entity responsible for making contributions to the resource
2023-12-15 by Darrell Ruby and Amy Mead/EM WG - recommended update MPox section. Syra Madad submitted updated version.
Coverage
The spatial or temporal topic of the resource, the spatial applicability of the resource, or the jurisdiction under which the resource is relevant
2025-12-15
Coronavirus
Crimean Congo Haemorrhagic Fever (CCHF)
Ebola
Flu
Influenza
Lassa
Marburg
MERS-CoV
Mpox
Plague
Protocol
R-EM
SARS
Special Pathogens
Viral Hemorrhagic Fever
-
https://repository.netecweb.org/files/original/9a92ec9e30d9df52712d7f7dd3ebdea8.pdf
c46b3c41c68616c4374a64ac835e8292
PDF Text
Text
HHS Public Access
Author manuscript
Author Manuscript
Clin Infect Dis. Author manuscript; available in PMC 2017 November 13.
Published in final edited form as:
Clin Infect Dis. 2017 September 01; 65(5): 855–859. doi:10.1093/cid/cix406.
Favipiravir and Ribavirin Treatment of Epidemiologically Linked
Cases of Lassa Fever
Author Manuscript
Vanessa N. Raabe1,a, Gerrit Kann2,a, Bruce S. Ribner1, Andres Morales3, Jay B. Varkey1,
Aneesh K. Mehta1, G. Marshall Lyon1, Sharon Vanairsdale4, Kelly Faber5, Stephan Becker6,
Markus Eickmann6, Thomas Strecker6, Shelley Brown7, Ketan Patel7, Philipp De Leuw2,
Gundolf Schuettfort2, Christoph Stephan2, Holger Rabenau8, John D. Klena7, Pierre E.
Rollin7, Anita McElroy7, Ute Ströher7, Stuart Nichol7, Colleen S. Kraft1,9,a, Timo Wolf2,a, and
for the Emory Serious Communicable Diseases Unitb
1Division
of Infectious Diseases, Emory University, Atlanta, Georgia
For permissions, journals.permissions@oup.com
Correspondence: C. S. Kraft, Emory University Hospital, Department of Pathology and Laboratory Medicine, 1364 Clifton Rd NE,
F145C, Atlanta, GA 30322 (colleen.kraft@emory.edu).
aV. N. R., G. K., C. S. K., and T. W. contributed equally to this work.
bMembers of the Emory Serious Communicable Diseases Unit are listed after the References.
Author Manuscript
Supplementary Data
Supplementary materials are available at Clinical Infectious Diseases online. Consisting of data provided by the authors to benefit the
reader, the posted materials are not copyedited and are the sole responsibility of the authors, so questions or comments should be
addressed to the corresponding author.
Author contributions
T. W., G. K., and C. S. K.: Treated the patient, collected data, wrote the manuscript. S. B. and M. E.: Performed virological analysis,
assisted in writing the manuscript, provided discussion of results. T. S.: Performed virological analysis, analyzed data. P. L.: Treated
the patient, collected data. G. S.: Treated the patient. C. S.: Treated the patient, provided discussion of the manuscript. H. R.: Assisted
in sample and data collection, provided discussion of the manuscript. V. N. R.: Collected data, wrote the manuscript. A. M.: Collected
data, edited the manuscript. B. S. R., J. B. V., A. K. M., G. M. L., S. V., and K. F.: Treated the patient, collected data, edited the
manuscript. S. B., J. D. K., P. E. R., U. S., S. N.: Performed virological analysis, analyzed data, edited the manuscript. K. P.:
Performed virological analysis, analyzed data. A. M.: Performed virological analysis, assisted in writing the manuscript, provided
discussion of results.
Disclaimer
The findings and conclusions in this report are those of the authors and do not necessarily represent the official position of the CDC.
Potential conflicts of interest. All authors: No reported conflicts of interest. All authors have submitted the ICMJE Form for
Disclosure of Potential Conflicts of Interest. Conflicts that the editors consider relevant to the content of the manuscript have been
disclosed.
Author Manuscript
Emory Serious Communicable Diseases Unit
SCD Unit Coordinator: Sonia Bell. Administration: Catherine Maloney, Pam Cosper, Nancye Feistritzer, John Lewin, Bryce Gartland,
Ira Horowitz, David Pugh, Chad Ritenour, Jerry Lewis, David Hatcher, Linda Scott-Harris, Lynne Ometer, Kip Hardy, Jeff Broughton,
Robert Jackson, Samantha Thomas. Nursing: Toni Ash, Christopher Barnes, Jamie Breedlove, Bob Bridgman, Lane Darragh, Tracey
Daye, Dustin Hillis, Crystal Johnson, Julie-Ann Johnson, Danni LaFond, Courtney Lyons, Josia Mamora, Anna McCord, Samantha
McDaniel, Haley Morgan, Jill Morgan, Alexander Sanchez, Marissa Simon, Jason Slabach, Kevin Tirado, Sally Watkins, Terrica
Wilson, Ken Logan. Emory Medical Labs: Juli Buchanan, Eileen Burd, John Cardella, Brenda Eaves, Crystal Evans, Charles Hill,
Doris Igwe, Karen Jenkins, Maureen Lindsey, Jordan Magee, Stacy McCarthy, Randall Powers, James Ritchie
Pharmacy: Jan Pack, Susan Rogers. Emory Health and Safety: Patricia Olinger, Kalpana Rengarajan, Scott Thomaston, Esmeralda
Meyer. Occupational Health: Emily Beck, Paula Desroches, Cynthia Hall, Celeste Walker Infection Prevention: Esther Baker, Betsy
Hackman. Environmental Services: Jeff Broughton, Robert Jackson, Jerry Lewis
Pastoral Care: Robin Brown-Haithco, Faith Richardson. Emory Faculty and Staff Assistance: Art Krasilovsky, Clevevoya Jordan, Sue
Matthews, Marilyn Hazzard Lineberger, Paula G. Gomes. Supplies/Logistics: Gentrice McGee, Porcia Jones. EUH Security: Linda
Scott-Harris, James Cain, Roderick Davis, Tyrone Johnson, Tyrone Pickett, Anthony Shaw, Tenina Truesdale. Emergency Medicine:
Alex Isakov, Sam Shartar, Wade Miles, Aaron Jamison, John Arevalo, Gail Stallings. Communications/Media Relations: Janet
Christenbury, Vince Dollard, Melanie De Gennaro, Holly Korschun. Nutrition: Tom Ziegler, Daniel P. Griffith, Nisha Dave
�Raabe et al.
Page 2
2Department
of Medicine, Infectious Diseases Unit, Goethe University Hospital, Frankfurt/Main,
Author Manuscript
Germany
3Samaritan’s
4Emory
Purse, Togo, West Africa
Healthcare, Atlanta, Georgia
5Hospital
of Hope, Mango, Togo
6Institute
of Virology and Germany Centre for Infectious Diseases Research (DZIF), GießenMarburg-Langen, Philipps University, Marburg, Germany
7US
Centers for Disease Control and Prevention, Viral Special Pathogens Branch, Atlanta,
Georgia
8Institute
of Medical Virology, University Hospital, Frankfurt, Germany
Author Manuscript
9Department
of Pathology and Laboratory Medicine, Emory University, Atlanta, Georgia
Abstract
Two patients with Lassa fever are described who are the first human cases treated with a
combination of ribavirin and favipiravir. Both patients survived but developed transaminitis and
had prolonged detectable virus RNA in blood and semen, suggesting that the possibility of sexual
transmission of Lassa virus should be considered.
Keywords
Lassa; favipiravir; ribavirin; Togo
Author Manuscript
Lassa fever (LF), a disease endemic to West Africa caused by infection with Lassa virus
(family Arenaviridae), causes an estimated 100 000–300 000 human cases annually [1].
Most cases are caused by infection from ingestion, inhalation, or direct contact with the
environmental reservoir, Mastomys natalensis rodents; human-to-human spread is
uncommon [2, 3]. Mortality among hospitalized patients ranges from 15% to 20% [1].
Treatment with ribavirin during the first 6 days of illness decreases mortality rates to 5% [4].
Favipiravir, a novel antiviral agent with broad-spectrum activity against RNA viruses,
decreases levels of Lassa viremia and increases survival in animal models [5, 6]. We
describe 2 cases of LF acquired via secondary spread from the same index case who
survived after treatment with ribavirin and favipiravir.
Author Manuscript
The index patient was a medical worker employed at a missionary institution in Oti District,
Togo. The index patient was medically evacuated to Cologne, Germany, after 2 weeks of
fevers, but died approximately 10 hours after admission despite intensive care. LF was
diagnosed postmortem by reverse-transcription polymerase chain reaction (RT-PCR) from a
liver biopsy (Gerd Fätkenheuer, submitted).
Clin Infect Dis. Author manuscript; available in PMC 2017 November 13.
�Raabe et al.
Page 3
Author Manuscript
CLINICAL COURSE AND TREATMENT
Patient E
Author Manuscript
Patient E is a previously healthy 33-year-old man who provided 7 days of nursing care to the
index patient in Togo and developed fevers 9 days after his last contact with the index
patient. A thick blood smear was positive for malaria and he received 3 days of artemether/
lumefantrine. LF was suspected when his fevers persisted and he developed sore throat,
retro-orbital headache, intermittent diminished hearing, diarrhea, malaise, and generalized
weakness. Laboratory testing in Togo revealed leukopenia with a nadir of 1 × 109 cells/L,
thrombocytopenia of 50 × 109 cells/L, mild transaminitis (aspartate aminotransferase 131
U/L, alanine aminotransferase 77 U/L), and creatinine of 2.3 mg/dL. Patient E received
ribavirin 2 g orally once followed by 1 g every 8 hours as intravenous ribavirin was not
immediately available. He was medically evacuated to the Serious Communicable Diseases
Unit at Emory University Hospital in Atlanta, Georgia, on day 8. An admission blood
specimen was positive for Lassa virus infection by conventional RT-PCR and retrospective
quantitative (q) RT-PCR (using laboratory-developed primers LV-Tog2 F
(TCACAACTCATCGCCTCATAC) and LV-Tog2 R (AATCTGTATGACCACGCACTC) and
of probe LV-Tog2 P (56-FAM/TCCATCTGT/ZEN/CCATCCCAAACTTCAACC/3IABkFQ)
with a cycle threshold value (Ct) of 23.4 (Figure 1A). On admission, intravenous ribavirin
16 mg/kg every 6 hours and oral favipiravir 2000 mg once followed by 1000 mg every 12
hours were administered after emergency investigational new drug approval was obtained
from the US Food and Drug Administration. On day 12, favipiravir was discontinued and
ribavirin was decreased to 8 mg/kg every 8 hours as per protocol from the manufacturer. He
completed his ribavirin regimen on day 15.
Author Manuscript
Initial vital signs included temperature 37.1°C, heart rate 50 beats/minute, respiratory rate 24
breaths/minute, and blood pressure 140/91 mm Hg. Examination revealed a thin, illappearing male with mild conjunctival pallor, oral thrush, a soft precordial systolic murmur,
and mild bladder distension with suprapubic tenderness. Tests for Ebola virus, human
immunodeficiency virus (HIV), and malaria were negative. The patient had fevers to a
maximum of 40.4°C, which resolved on day 12, and intermittent headaches. He developed
nausea, which he attributed to favipiravir. His appetite improved and his sore throat resolved
on day 14. He developed painful diffuse lymphadenopathy on day 14, epididymitis between
days 19 and 21 (which later correlated to semen culture positivity for Lassa), and night
sweats on day 22. He was discharged on day 25. His hearing slowly improved, although
subjective right-sided decreased hearing persisted for 4 months despite normal audiological
testing.
Author Manuscript
Patient F
Patient F is a mortician who prepared the index patient’s corpse for repatriation 11 days after
the patient’s death. He was ill with mild upper respiratory tract symptoms prior to contact
with the deceased patient, making the first day of symptoms due to LF difficult to clarify.
Qualitative PCR for LF was ordered by the health authorities 2 days after contact with the
corpse due to temperatures between 37.5°C and 38.0°C (illness day 1) with an inconclusive
result (1 faint band in 1 of 3 parallel assays). His condition deteriorated over 3 days with
Clin Infect Dis. Author manuscript; available in PMC 2017 November 13.
�Raabe et al.
Page 4
Author Manuscript
fevers to 38.2°C, pronounced generalized weakness, myalgia, arthralgias, headache, and
nausea. Repeat qRT-PCR testing 4 days later was positive (Ct 31.0; Figure 1B), and he was
transferred to the Frankfurt University High-Level Isolation unit.
Initial vital signs were temperature 38.9°C, blood pressure 145/75 mm Hg, and heart rate 77
beats/minute. Examination revealed dry mucous membranes, pharyngeal erythema with
patchy white exudates, conjunctival injection, a faint macular rash on the epigastrium, and
slowed rapport and speech. Diagnostic testing was negative for HIV, hepatitis B and C,
influenza, and group A Streptococcus pharyngitis. His fevers resolved on day 7 and his
myalgias and arthralgias gradually improved. He developed nonproductive coughing without
chest radiographic abnormalities. His pharyngitis worsened during the first week and
resolved during week 3. He was discharged on day 39 after his symptoms resolved.
Author Manuscript
He received 1000 mg of intravenous ribavirin followed by 1000 mg every 6 hours for 4 days
followed by 500 mg intravenously every 8 hours for another 6 days per the World Health
Organization protocol [7]. Oral favipiravir 2000-mg loading dose was administered followed
by 1200 mg twice daily for 4 days. He developed atrial fibrillation 2.5 hours after initiation
of favipiravir and 10.5 hours after ribavirin. Therapeutic heparin treatment was administered.
Four hours after discontinuation of favipiravir and 14 hours after ribavirin dose reduction, he
converted to sinus rhythm.
LABORATORY STUDIES
Author Manuscript
For both patients, clinical laboratory support was provided as described in Supplementary
Data 1 and initial molecular testing was performed as previously described [8, 9]. Patientspecific qRT-PCR assays were developed, designated LV-Tog2 for patient E and LV-Tog1 for
patient F (Supplementary Data 1). Pertinent laboratory results for both patients are shown in
Figures 2A and 2B, respectively. Lassa immunoglobulin M (IgM) antibodies were detected
on day 13 in patient E and immunoglobulin G (IgG) antibodies were detected on day 46 in
patient E and day 38 in patient F. IgM was not tested in patient F.
Author Manuscript
Cell culture by Vero cell culture for Lassa virus was positive from whole blood specimens
from patient E on days 8, 9, and 11 and patient F on day 5. Lassa virus nucleic acid was
detected in blood samples by qRT-PCR in patient E through day 59 (Figure 1A) with 1
exception and in patient F through day 28 (Figure 1B). Patient E had 6 positive RT-PCR
assays from urine samples but virus was not isolated from urine by cell culture. Urine testing
on patient F yielded 1 positive RT-PCR on day 22. Saliva RT-PCRs were intermittently
positive from patient E through day 46 and pharyngeal swab RT-PCRs from patient F were
positive through day 28. Three semen samples from patient E (days 15, 20, and 48) and 4
samples from patient F (days 35, 46, 82, and 103) all had detectable Lassa virus RNA by
qPCR. Culture yielded Lassa virus in 1 semen sample from patient E on day 20.
DISCUSSION
We report 2 epidemiologically linked patients with LF secondarily acquired from the same
index case treated with favipiravir and ribavirin and who made full recovery. Ribavirin, the
only previously described anti-LF therapy associated with reduced mortality in humans, was
Clin Infect Dis. Author manuscript; available in PMC 2017 November 13.
�Raabe et al.
Page 5
Author Manuscript
Author Manuscript
initiated on day 6 (patient E) and day 5 (patient F). Favipiravir is licensed for influenza
treatment in Japan and may reduce mortality in other RNA virus infections, including Ebola
virus disease [10]. Favipiravir was started on day 8 (patient E) and day 5 (patient F) but was
discontinued after 5 days of treatment in both patients due to nausea and worsening
transaminitis. Transaminitis has been described in LF in both untreated and ribavirin-treated
patients [4, 11], so it was unclear if the patients’ transaminitis was due to their underlying
disease vs a drug effect. In both patients, aminotransferase levels declined shortly after
discontinuation of favipiravir and decreases in the ribavirin dose. Both patients also showed
a decline in hemoglobin (Figure 2A and 2B) with an elevated lactate dehydrogenase and
bilirubin in patient F, which may partially be explained by a toxic effect of ribavirin and
metamizole. Viral copy number values declined on therapy, although given the lack of
comparator patients or sufficient historical data using PCR methods, it remains unclear
whether this was due to an effect of combined antiviral therapy or the normal course of
Lassa viremia. The utility of combined ribavirin and favipiravir treatment for LF should be
evaluated in further clinical studies.
Viral nucleic acid was detected for a prolonged period in both patients in blood (days 27 and
62) and semen (days 48 and 103). The long-term persistence of viable virus in convalescent
patients in immune-privileged compartments has been described for Ebola virus in ocular
and seminal fluid [12–14]. Arenavirus escape attributed to evasion of immune system
antigen presentation has been shown to contribute to long-term virus excretion in natural and
dead-end hosts [15]. Well-documented longitudinal molecular detection of Lassa virus in
semen has not been previously published, raising the possibility that Lassa virus could be
sexually transmitted.
Author Manuscript
Supplementary Material
Refer to Web version on PubMed Central for supplementary material.
Acknowledgments
We thank Sarah Katharina Fehling and Svenja Wolff for virus isolation work and Michael Schmidt and Gotthard
Ludwig for technical support in the biosafety level 4 facility at the Philipps University of Marburg. We express our
gratitude to the nursing staff of the intensive care pool and the Infectious Diseases Department, University Hospital
Frankfurt. We thank Debi Cannon, Cheng-Feng Chiang, William Davis, Aridth Gibbons, James Graziano, Mary
Jenks, Maria Morales-Betouille and Nishi Patel for their assistance in performance of the laboratory testing at the
Centers for Disease Control and Prevention (CDC). We are appreciative of the support of the US Food and Drug
Administration, Valeant, and Medivector for the provision of the therapeutics for these patients. We thank the
Investigational Drug Service at Emory University and the Emory University Institutional Review Board.
Author Manuscript
References
1. Centers for Disease Control and Prevention. Lassa fever. Available at: https://www.cdc.gov/vhf/
lassa/. Accessed 18 March 2017.
2. Haas WH, Breuer T, Pfaff G, et al. Imported Lassa fever in Germany: surveillance and management
of contact persons. Clin Infect Dis. 2003; 36:1254–8. [PubMed: 12746770]
3. Lo Iacono G, Cunningham AA, Fichet-Calvet E, et al. Using modelling to disentangle the relative
contributions of zoonotic and anthroponotic transmission: the case of Lassa fever. PLoS Negl Trop
Dis. 2015; 9:e3398. [PubMed: 25569707]
Clin Infect Dis. Author manuscript; available in PMC 2017 November 13.
�Raabe et al.
Page 6
Author Manuscript
Author Manuscript
Author Manuscript
4. McCormick JB, King IJ, Webb PA, et al. Lassa fever. Effective therapy with ribavirin. N Engl J
Med. 1986; 314:20–6. [PubMed: 3940312]
5. Safronetz D, Rosenke K, Westover JB, et al. The broad-spectrum antiviral favipiravir protects guinea
pigs from lethal Lassa virus infection post-disease onset. Sci Rep. 2015; 5:14775. [PubMed:
26456301]
6. Oestereich L, Rieger T, Lüdtke A, et al. Efficacy of favipiravir alone and in combination with
ribavirin in a lethal, immunocompetent mouse model of Lassa fever. J Infect Dis. 2016; 213:934–8.
[PubMed: 26531247]
7. World Health Organization. Communicable diseases toolkit Sierra Leone. Available at: http://
apps.who.int/iris/bitstream/10665/68741/1/WHO_CDS_2004.25_%28Profile%29.pdf. Accessed 14
June 2016.
8. Olschläger S, Lelke M, Emmerich P, et al. Improved detection of Lassa virus by reverse
transcription-PCR targeting the 5′ region of S RNA. J Clin Microbiol. 2010; 48:2009–13.
[PubMed: 20351210]
9. Vieth S, Drosten C, Lenz O, et al. RT-PCR assay for detection of Lassa virus and related Old World
arenaviruses targeting the L gene. Trans R Soc Trop Med Hyg. 2007; 101:1253–64. [PubMed:
17905372]
10. Sissoko D, Laouenan C, Folkesson E, et al. JIKI Study Group. Experimental treatment with
favipiravir for Ebola virus disease (the JIKI trial): a historically controlled, single-arm proof-ofconcept trial in Guinea. PLoS Med. 2016; 13:e1001967. [PubMed: 26930627]
11. Schmitz H, Köhler B, Laue T, et al. Monitoring of clinical and laboratory data in two cases of
imported Lassa fever. Microbes Infect. 2002; 4:43–50. [PubMed: 11825774]
12. Varkey JB, Shantha JG, Crozier I, et al. Persistence of Ebola virus in ocular fluid during
convalescence. N Engl J Med. 2015; 372:2423–7. [PubMed: 25950269]
13. Uyeki TM, Erickson BR, Brown S, et al. Ebola virus persistence in semen of male survivors. Clin
Infect Dis. 2016; 62:1552–5. [PubMed: 27045122]
14. Sow MS, Etard JF, Baize S, et al. Postebogui Study Group. New evidence of long-lasting
persistence of Ebola virus genetic material in semen of survivors. J Infect Dis. 2016; 214:1475–6.
[PubMed: 27142204]
15. Schildknecht A, Welti S, Geuking MB, Hangartner L, van den Broek M. Absence of CTL
responses to early viral antigens facilitates viral persistence. J Immunol. 2008; 180:3113–21.
[PubMed: 18292534]
Author Manuscript
Clin Infect Dis. Author manuscript; available in PMC 2017 November 13.
�Raabe et al.
Page 7
Author Manuscript
Author Manuscript
Author Manuscript
Author Manuscript
Figure 1.
Patient E (A) and patient F (B): Symbols represent different samples taken from different
body fluids. Filled symbols represent body fluid samples from which a viral isolate was
recovered. Positive culture results and positive qualitative polymerase chain reaction (PCR)
results are indicated by cycle threshold values ranging from 10 to 15. Symbols below the red
bar indicate body fluid samples testing negative by PCR. The presence of immunoglobulin
G, immunoglobulin M, duration of treatment, duration of symptoms, and duration of clinical
examination findings are indicated by the bars underneath. Abbreviations: A. Fib, atrial
Clin Infect Dis. Author manuscript; available in PMC 2017 November 13.
�Raabe et al.
Page 8
Author Manuscript
fibrillation; Dim. Hearing, diminished hearing; IgG, immunoglobulin G; IgM,
immunoglobulin M; LAD, painful lymphadenopathy; PCR, polymerase chain reaction.
Author Manuscript
Author Manuscript
Author Manuscript
Clin Infect Dis. Author manuscript; available in PMC 2017 November 13.
�Raabe et al.
Page 9
Author Manuscript
Author Manuscript
Author Manuscript
Figure 2.
A, White blood cell (WBC) count, hemoglobin (HgB), and platelet (Plt) counts for patient E
(triangles) and patient F (circles). B, Aspartate aminotransferase (AST), alanine
aminotransferase (ALT), total bilirubin, lactate dehydrogenase, and creatinine values for
patient E (triangles) and patient F (circles).
Author Manuscript
Clin Infect Dis. Author manuscript; available in PMC 2017 November 13.
�
Dublin Core
The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.
Title
A name given to the resource
Favipiravir and Ribavirin Treatment of Epidemiologically Linked Cases of Lassa Fever
Dublin Core
The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.
Title
A name given to the resource
Develop
Description
An account of the resource
<h2><span>These files will help you <strong><em>develop</em></strong> your program and plans based on what you have discovered.</span></h2>
<p style="font-size:120%;">Find model protocols and procedures and more in-depth training resources. You can go to the <a href="/exhibits/show/leadership"><button>Leadership Toolbox</button></a> or the <a href="https://repository.netecweb.org/exhibits/show/specialpopulations"><button>Special Populations</button></a> section. You can also go to the <a href="https://repository.netecweb.org/exhibits/show/netec-education/justintime"><button> Just in Time Training</button></a> page, the <a href="https://repository.netecweb.org/exhibits/show/ppe101/ppe"><button> PPE</button></a> page, or the <a href="https://repository.netecweb.org/exhibits/show/ems/prehospital"><button>EMS</button></a> page. <span>Subscribe to the NETEC <a href="https://www.youtube.com/channel/UCDpHc1LkcEpiWR0q7ll5eZQ" target="_blank" rel="noreferrer noopener"><button>Youtube Channel</button></a> to get all new Skills videos!</span></p>
Publication
A peer reviewed publication.
URL
https://www.ncbi.nlm.nih.gov/pubmed/29017278
Read Online
Online location of the resource.
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5682919/
Citation
Citation information for the publication itself.
Raabe, V. N., G. Kann, B. S. Ribner, A. Morales, J. B. Varkey, A. K. Mehta, G. M. Lyon, S. Vanairsdale, K. Faber, S. Becker, M. Eickmann, T. Strecker, S. Brown, K. Patel, P. De Leuw, G. Schuettfort, C. Stephan, H. Rabenau, J. D. Klena, P. E. Rollin, A. McElroy, U. Stroher, S. Nichol, C. S. Kraft, T. Wolf and U. Emory Serious Communicable Diseases (2017). "Favipiravir and Ribavirin Treatment of Epidemiologically Linked Cases of Lassa Fever." Clin Infect Dis 65(5): 855-859.
Abstract
Two patients with Lassa fever are described who are the first human cases treated with a combination of ribavirin and favipiravir. Both patients survived but developed transaminitis and had prolonged detectable virus RNA in blood and semen, suggesting that the possibility of sexual transmission of Lassa virus should be considered.
Accessibility
Information on accessibility of the document(s), such as university log-in necessary, request form, open access, etc.
free online - Pubmed Central
Dublin Core
The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.
Title
A name given to the resource
Favipiravir and Ribavirin Treatment of Epidemiologically Linked Cases of Lassa Fever
Creator
An entity primarily responsible for making the resource
Raabe, V. N., G. Kann, B. S. Ribner, A. Morales, J. B. Varkey, A. K. Mehta, G. M. Lyon, S. Vanairsdale, K. Faber, S. Becker, M. Eickmann, T. Strecker, S. Brown, K. Patel, P. De Leuw, G. Schuettfort, C. Stephan, H. Rabenau, J. D. Klena, P. E. Rollin, A. McElroy, U. Stroher, S. Nichol, C. S. Kraft, T. Wolf and U. Emory Serious Communicable Diseases
Subject
The topic of the resource
Treatment & Care
Description
An account of the resource
Two patients with Lassa fever are described who are the first human cases treated with a combination of ribavirin and favipiravir.
Date
A point or period of time associated with an event in the lifecycle of the resource
2017-09-01
Type
The nature or genre of the resource
Publication
Coverage
The spatial or temporal topic of the resource, the spatial applicability of the resource, or the jurisdiction under which the resource is relevant
2024-09-27
Contributor
An entity responsible for making contributions to the resource
2022-09-27 - general asset review - Treatment & Care group
Example
Lassa
Patient Care
R-Res&Pub
R-T&C
Therapeutics
-
https://repository.netecweb.org/files/original/e474bb66c2d8c273bd561440c89cd91f.pdf
5614859e9a1d3f9940d359b509d63f29
PDF Text
Text
International Journal of Infectious Diseases 119 (2022) 187–200
Contents lists available at ScienceDirect
International Journal of Infectious Diseases
journal homepage: www.elsevier.com/locate/ijid
Review
Lassa Virus Infection: a Summary for Clinicians
Vanessa Raabe a,∗∗, Aneesh K Mehta b, Jared D. Evans c,∗ , On behalf of the following
members of the State of the Science Working Group of the National Emerging Special
Pathogens Training and Education Center (NETEC) Special Pathogens Research Network
(SPRN), Adam Beitscher d, Nahid Bhadelia e, David Brett-Major f, Theodore J Cieslak f,
Richard T Davey g, Jared D Evans h, Maria G Frank d, Peter Iwen f, Mark G Kortepeter i,
Corri Levine j, Susan McLellan j, Aneesh K Mehta k, Lauren Sauer f, Erica S Shenoy m,
Kimon Zachary m
d
Denver Health Medical Center, Denver, CO
Boston University Hospital, Boston, MA
f
University of Nebraska Medical Center, Omaha, NE
g
National Institute of Allergy and Infectious Diseases, Bethesda, MD
h
Johns Hopkins Applied Physics Laboratory, Laurel, MD
i
Uniformed Services University of the Health Sciences, Bethesda, MD
j
University of Texas Medical Branch, Galveston, TX
k
Emory University, Atlanta, GA
l
New York University Grossman School of Medicine, New York, NY
m
Massachusetts General Hospital, Boston, MA
a
New York University Grossman School of Medicine, New York, NY
b
Emory University School of Medicine, Atlanta, GA
c
Johns Hopkins Applied Physics Laboratory, Laurel, MD
e
a r t i c l e
i n f o
Article history:
Received 18 February 2022
Revised 1 April 2022
Accepted 3 April 2022
Keywords:
Lassa virus
Lassa fever
antiviral therapy
antiviral countermeasure
vaccine
viral hemorrhagic fever
a b s t r a c t
Objectives: This summary on Lassa virus (LASV) infection and Lassa fever disease (LF) was developed
from a clinical perspective to provide clinicians with a condensed, accessible understanding of the current literature. The information provided highlights pathogenesis, clinical features, and diagnostics emphasizing therapies and vaccines that have demonstrated potential value for use in clinical or research
environments.
Methods: We conducted an integrative literature review on the clinical and pathological features, vaccines, and treatments for LASV infection, focusing on recent studies and in vivo evidence from humans
and/or non-human primates (NHPs), when available.
Results: Two antiviral medications with potential benefit for the treatment of LASV infection and 1 for
post-exposure prophylaxis were identified, although a larger number of therapeutic candidates are currently being evaluated. Multiple vaccine platforms are in pre-clinical development for LASV prevention,
but data from human clinical trials are not yet available.
Conclusion: We provide succinct summaries of medical countermeasures against LASV to give the busy
clinician a rapid reference. Although there are no approved drugs or vaccines for LF, we provide condensed information from a literature review for measures that can be taken when faced with a suspected
infection, including investigational treatment options and hospital engineering controls.
© 2022 The Authors. Published by Elsevier Ltd on behalf of International Society for Infectious Diseases.
This is an open access article under the CC BY-NC-ND license
(http://creativecommons.org/licenses/by-nc-nd/4.0/)
∗
Corresponding authors: Jared D. Evans, PhD, Johns Hopkins Applied Physics Laboratory, Research and Exploratory Development Department, School of Medicine,
11100 Johns Hopkins Rd., Laurel, MD 20732, (240) 758-8133
∗∗
Vanessa Raabe, MD, New York University Grossman, 430 E 29th Street, ACLS
West Tower, 3rd Floor, New York, NY 10016, 646-754-2682.
E-mail
addresses:
Vanessa.Raabe@nyulangone.org
(V.
Raabe),
aneesh.mehta@emory.edu (A.K. Mehta), jared.evans@jhuapl.edu (J.D. Evans).
Introduction
Lassa virus (LASV) is an enveloped, segmented RNA virus in
the family Arenaviridae, genus Mammarenavirus. This virus is classified in the Old World mammarenavirus complex that circulates
https://doi.org/10.1016/j.ijid.2022.04.004
1201-9712/© 2022 The Authors. Published by Elsevier Ltd on behalf of International Society for Infectious Diseases. This is an open access article under the CC BY-NC-ND
license (http://creativecommons.org/licenses/by-nc-nd/4.0/)
�V. Raabe, A.K. Mehta, J.D. Evans et al.
International Journal of Infectious Diseases 119 (2022) 187–200
in West and Central Africa and is closely related to lymphocytic
choriomeningitis virus, Mopeia virus, and Lujo virus (Klitting et al.,
2020). A total of 7 lineages have been identified, 4 of which are
found in Nigeria; 1 in Mali and Cote d’Ivoire, 1 in Togo, and 1 in
Sierra Leone, Guinea, and Liberia (Ehichioya et al., 2019; Forni and
Sironi, 2020). The genetic variation between strains is as high as
27% at the nucleoprotein level and 15% at the amino acid level
(Bowen et al., 20 0 0). This diversity may account for some of the
variability in clinical presentation and present challenges for diagnostic assays and vaccines. Most human infections with LASV result from the rodent-to-human transmission, although human-tohuman infection may occur, especially in health care settings. A
large proportion of human infections are asymptomatic or unrecognized; however, a minority result in a potentially severe symptomatic disease, known as Lassa fever (LF). LF is difficult to diagnose clinically, as symptoms resemble many other common infections in the region, such as influenza, malaria, and typhoid fever. In
locations where undiagnosed febrile diseases are common, various
diagnostic assays are available to confirm the diagnosis. Vaccines
against LASV are in development but are not approved for use and
have not yet been widely studied in humans. Historically, ribavirin,
a small molecule direct-acting antiviral drug, has been used for
treatment and post-exposure prophylaxis against LF. Other novel
products, including favipiravir, remain the subject of investigational
studies. Finally, new therapeutic options, such as monoclonal antibodies, are being pursued in animal models, including non-human
primates (NHPs).
targets for medical countermeasures against LASV. We present an
overview of these processes to provide a mechanistic context for
potential therapeutics. For a more complete review, see study by
Loureiro et al., 2019. The LASV glycoprotein studs the virus envelope and is cleaved into 2 smaller peptides, which bind the
host cellular receptor alpha-dystroglycan, which is expressed in
a broad range of tissues (Cao et al., 1998; Herrador et al., 2019;
Spiropoulou et al., 2002). Alternative receptors include T-cell immunoglobulin and mucin domain 1, Tyro3, dendritic cell-specific
intercellular adhesion molecule-grabbing nonintegrin, liver and
lymph node sinusoidal endothelial calcium-dependent lectin, and
Axl (Brouillette et al., 2018; Fedeli et al., 2018; Shimojima et al.,
2012). Virus entry can also occur through macropinocytosis, where
the glycoprotein complex binds to endosomal lysosomal-associated
lembrane protein 1 (LAMP1) for virus fusion with subsequent
genome release into the cytoplasm, although LAMP1-independent
virus fusion may occur (Israeli et al., 2017; Jae et al., 2014;
Li et al., 2016; Markosyan et al., 2021). Previous work has discovered small molecules that inhibit LASV entry or membrane fusion in vitro, but none have advanced to clinical testing for LF
(Herring et al., 2021; Hulseberg et al., 2019; Markosyan et al., 2021;
Nunberg and York, 2012; Shankar et al., 2016; Takenaga et al.,
2021; Wang P. et al., 2018; Zhang et al., 2019; Zhang et al.,
2020). Genome replication is carried out by virally encoded polymerase, nucleoprotein, and the Z protein (Loureiro et al., 2012).
Viral genome replication is the main target for existing antiviral
therapies for LF, including ribavirin and favipiravir. However, other
virus-host protein interactions have been identified during replication that could be targeted for therapeutics. The DEAD-Box RNA
Helicase 3 (DDX3), which is involved in multiple steps in RNA
metabolism and cell cycle control, interacts with the LASV nucleoprotein (Chang et al., 2006; Lai et al., 2010; Loureiro et al., 2018).
DDX3 is believed to play a role in LASV replication; when DDX3
is decreased in cell culture, LASV replication is greatly diminished
(Loureiro et al., 2018). LASV is packaged in a stepwise process
through an endoplasmic reticulum to Golgi transition, ending in
a budding event at the cell membrane requiring cellular factors
tumor susceptibility gene 101, vacuolar protein sorting-associated
protein 4A, and vacuolar protein sorting-associated protein 4B
(Urata et al., 2006). Countermeasures that interfere with posttranslational protein modification or the LASV Z protein, which
plays a critical role in viral budding from the cellular membrane,
are in development but not yet in pre-clinical testing (Andrei and
De Clercq, 1990; Lee et al., 2011; McLay et al., 2013; Xu et al.,
2021).
Immune cells, such as dendritic cells and macrophages, may
be directly infected by LASV without an expression or upregulation of immune costimulatory molecules, which leads to poor proinflammatory cytokine expression and T-cell activation (Baize et al.,
20 09; Mahanty et al., 20 03; Pannetier et al., 2014; Pannetier et al.,
2011). Type I interferons play an important role in limiting LASV
replication and aid in viral clearance. However, similar to many
pathogenic viruses, LASV has strategies to evade the innate immune response (Baize et al., 2006; Yun et al., 2012; Qi et al., 2010;
Schaeffer et al., 2018). The LASV Z protein can inhibit molecules
associated with viral RNA detection, such as retinoic acid-inducible
gene I signaling and melanoma differentiation-associated protein 5 (Huang et al., 2020; Xing et al., 2015). The LASV nucleoprotein can block nuclear factor-κ B transcription activity, limiting the expression of antiviral immune responses, suppressing
type I interferon production, and inhibiting natural killer cell responses (Rodrigo et al., 2012; Carnec et al., 2011; Qi et al., 2010;
Russier et al., 2014). The L protein and nucleoprotein produced
by LASV, in addition, prevent double-stranded RNA from accumulating in cells and block interferon regulatory factor 3 from
translocating into the nucleus, circumventing RNA detection mech-
Methods
A focused literature review was conducted emphasizing recent updates in medical countermeasures from 2016 to 2021, although older studies were also included where relevant. Bibliography scans were also completed on review articles. Medical countermeasures against LASV used in human clinical research or NHP
studies were the focus of this review.
This review is one in a series of articles on the management
of severe diseases caused by emerging viral pathogens, including
Marburg, Crimean Congo hemorrhagic fever, LF, Nipah, smallpox,
and South American Hemorrhagic Fever viruses (Frank et al., 2021;
Kortepeter et al., 2020). Viruses were selected by the members of
the State of the Science Working Group of the Special Pathogens
Research Network within the National Emerging Special Pathogens
Training and Education Center (NETEC). The NETEC is funded by
the Assistant Secretary of Preparedness and Response and the Centers for Disease Control and Prevention to improve public health
and health care systems in the United States to respond effectively to individuals infected with suspected or confirmed special
pathogens. Criteria used to select the pathogens for review included the following: relative rarity of the diseases, high infectivity and communicability, severity of the illness, potential to cause
large-scale outbreaks, the potential need for specialized infection
control management based on their historic ability to cause nosocomial infection in the hospital or field setting, and their paucity
or lack of licensed countermeasures.
After the publication of this article, updated information on the
management of LF will be made available on the NETEC website:
www.netec.org.
Clinical Features
Incubation period: The incubation period for LF is 2 to 21 days
following exposure (Asogun et al., 2019; Jahrling P. B. and Peters C.
J., 1984).
Pathogenesis: The interactions between LASV and cellular proteins involved in viral entry and replication represent potential
188
�V. Raabe, A.K. Mehta, J.D. Evans et al.
International Journal of Infectious Diseases 119 (2022) 187–200
anisms that normally contribute to interferon production in the
setting of viral infection (Hastie et al., 2011; Hastie et al., 2012;
Jiang et al., 2013; Mateer et al., 2020). Although NHPs who survive
LF demonstrate early interferon responses and activated T-cells, fatal cases have delayed interferon production and poor T-cell activation (Baize et al., 2009). Although cellular immune responses
play a critical role in recovery from LASV infection, there is evidence that shows that T-cells also contribute to disease pathology
(Flatz et al., 2010; Oestereich et al., 2016a; Port et al., 2020). Interventions that modulate the immune system response to assist
with LASV control or dampen immune-mediated damage represent
a possible future area of medical countermeasures research for LF.
However, to date, clinical studies of immunological interventions
have been limited to antibody-based therapeutics and vaccines.
Clinical spectrum of infection: Human LASV infection results in
a wide spectrum of clinical outcomes from asymptomatic to fatal
viral hemorrhagic fever. The manifestations of LF are variable and
resemble those of other commonly encountered infections, such as
influenza, malaria, rickettsia, typhoid fever, and other viral hemorrhagic fevers such as Ebola virus disease. Acute symptoms associated with LF may include abdominal pain, abnormal bleeding,
anorexia, arthralgia, back or chest pain, conjunctivitis, cough, diarrhea, difficulty breathing, dizziness, dysuria, facial edema, fatigue,
fever, headache, malaise, myalgia, nausea, pharyngitis (often exudative), vomiting, and weakness (Bausch et al., 2001; Ilori et al.,
2019; Ipadeola et al., 2020, Jeffs, 2006; McCormick et al., 1987a;
Richmond and Baglole, 2003; Samuels et al., 2020; Shehu et al.,
2018). Pharyngitis is recognized as a distinctive symptom that can
distinguish LF from other endemic diseases, occurring in 70% of
a well-described hospital cohort (McCormick et al., 1987a). Severe cases may develop facial edema in the absence of peripheral edema (McCormick et al., 1987a). LASV can invade the central nervous system (Gunther et al., 2001; Johnson et al., 1987;
Okokhere P. O. et al., 2018). In severe cases, neurological symptoms such as altered consciousness, seizures, and tremors have
been reported, and hearing loss is the most common reported
focal neurologic deficit (Cummins et al., 1992; McCormick et al.,
1987a; Okokhere P. et al., 2018; Okokhere P. O. et al., 2018). In children, LF may present with “swollen baby syndrome” characterized
by abdominal distension, bleeding, and diffuse edema, which has
been reported in children up to 9 years of age and carries an estimated case fatality rate of 83% (Monson et al., 1987). The most
common symptoms associated with pediatric LF among hospitalized patients in Sierra Leone, with prevalence in ≥50% of patients,
were cough, vomiting, headache, sore throat, pain, and facial/neck
edema. In contrast, fever and bleeding were present in ≤50% of
hospitalized pediatric patients (Samuels et al., 2020). Congenital
LASV infection, defined as symptom onset ≤5 days after delivery,
has been reported (Monson et al., 1987).
Clinical course: Similar to other viral hemorrhagic fevers, LF
symptoms evolve over the course of the illness. Early symptoms
include fever, chills, malaise, and muscle aches, whereas abdominal pain, back pain, cough, diarrhea, headache, joint pain, sore
throat, and vomiting frequently develop during days 3 to 5 of illness (Frame et al., 1970; McCormick et al., 1987a; Monath et al.,
1974). Severe illness, including hypotension and shock, may occur
as early as the end of the first week of illness (McCormick et al.,
1987a). Among survivors, recovery is generally observed in the second and third weeks after the onset of illness (McCormick et al.,
1987a, Monath et al., 1974).
Mortality risk factors: Recent analyses of the literature suggest
the case fatality rate of LF in humans is approximately 30% in patients who present to health care environments (Kenmoe et al.,
2020; Merson et al., 2021). Pregnant women have increased odds
of death, with an overall odds ratio of 2.86 for death compared
with non-pregnant women with LF and an odds ratio of over
5 when presenting in the third trimester (Kayem et al., 2020;
Price et al., 1988). Approximately 90% of pregnancies are lost
among pregnant women with LF (Wauquier et al., 2020). A number of other markers have been correlated with poor outcomes,
including elevated serum aspartate aminotransferase levels, elevated clinical scores (National Early Warning Score Version 2 ≥ 7),
high viremia (≥103.6 median tissue culture infectious dose50 /mL or
cycle threshold values ≤30), older age (≥45 years), the presence
of acute kidney injury (Kidney Disease-Improving Global Outcome
grade ≥ 2; stage ≥ 2 acute kidney injury in children), and infection with LASV strains circulating in Nigeria (Adetunji et al., 2021;
Asogun et al., 2012; Duvignaud et al., 2021; McCormick et al., 1986;
Okokhere P. et al., 2018). Hospitalized children with LF in Sierra
Leone with positive antigen tests experience high mortality (63%)
(Samuels et al., 2020).
Pathology: Like other viral hemorrhagic fever viruses, LASV distributes widely in the body, including the brain, parotid and submandibular glands, lymphoid tissue, mucosal tissue, lungs, heart,
liver, spleen, pancreas, adrenal glands, kidney, bladder, testis, ovary,
endometrium, placenta, breast, bone marrow, vascular endothelial cells, mesothelial cells, serosal membranes, and skeletal muscle (Hensley et al., 2011; Shieh et al., 2021; Stein et al., 2021;
Walker et al., 1975). Thrombocytopenia and transient lymphopenia
can occur, along with a monocytosis during the second week of infection (Baize et al., 2009; Fisher-Hoch et al., 1988; Hensley et al.,
2011). Pleural and pericardial effusion have been observed in human cases (Edington and White, 1972; McCormick et al., 1987a;
Monath et al., 1974). Pathological findings associated with LASV
infection may include organ necrosis, hemorrhage, edema, interstitial pneumonia, and inflammation, including vasculitis (Baize et al.,
2009; Callis et al., 1982; Fisher-Hoch and McCormick, 1987;
Hensley et al., 2011; Stein et al., 2021; Walker et al., 1982;
Walker et al., 1975; Winn and Walker, 1975). Hearing loss may
occur because of damage to cochlear hair cells and the auditory nerve or perivascular inflammation in the ear, which has
been demonstrated in mouse models of LF (Huynh et al., 2020;
Yun et al., 2015).
Sequelae: Long-term sequela have been reported after LASV infection, including sensorineural hearing loss (in as many as 1 in
3 confirmed, symptomatic LASV infections in some settings), ophthalmological abnormalities, difficulty speaking, hair loss, and balance problems, including cerebellar ataxia (Cummins et al., 1990;
Ezeomah et al., 2019; Ficenec et al., 2020; Ibekwe et al., 2011;
Li et al., 2020; McCormick et al., 1987a; World Health Organization, 2017b). Delayed onset paraparesis after LF has been reported
(Duvignaud et al., 2020). Spontaneous abortion or fetal demise
after birth occurs commonly among pregnant patients with LF
(McCormick et al., 1987a; Monson et al., 1987; Price et al., 1988). In
studies from Nigeria, survivors with severe acute kidney injury, including those who required hemodialysis, recovered renal function
to normal levels (Okokhere 2018, Lancet ID). Social isolation and
stigmatization among LF survivors remain problematic in recovery
efforts (Ficenec et al., 2020; Usifoh et al., 2019).
Diagnostic testing: Although whole blood may also be used,
collection of blood, preferably in ethylenediaminetetraacetic acid
(EDTA) tubes, is recommended for Lassa diagnostic testing. Personal protective equipment should be worn when performing
phlebotomy, including long-sleeved gowns or disposable coverall
suits, a face mask, goggles or a face shield, rubber boots/shoe
covers, and gloves. Following collection, samples should be enclosed in a second plastic, leak-proof container. Unless local
Lassa diagnostic testing is available, specimens will need to be
shipped to a national, regional, or international reference laboratory capable of performing Lassa diagnostic testing. Detailed
guidance regarding the safe collection and preparation of blood
samples from individuals with suspected Lassa infection for
189
�V. Raabe, A.K. Mehta, J.D. Evans et al.
International Journal of Infectious Diseases 119 (2022) 187–200
transport and shipping to reference laboratories for diagnostic
testing may be found at https://www.who.int/publications/i/
item/how- to- safely- collect- blood- samples- by- phlebotomy- frompatients- suspected- to- be- infected- with- lassa- fever, https://www.
who.int/publications/i/item/9789241549608, and https://www.who.
int/images/default-source/health-topics/lassa-fever/how-to-safelyship- human- blood- samples- from- lassa.tmb- 479v.png?sfvrsn=
6bb3dab3_6. Appropriate national public health authorities should
be notified of suspected LASV infections, if not already notified, at
the time Lassa diagnostic testing is arranged.
Comprehensive reviews of diagnostic assays for LASV have
been published recently elsewhere (Happi et al., 2019; Raabe and
Koehler, 2017). In brief, multiple laboratory modalities may be used
to directly detect LASV infection, including nucleoprotein antigen
detection assays, nucleic acid amplification technology, immunohistochemistry, and, in settings where high biocontainment laboratory facilities exist, viral culture may be considered. LASV infection may also be indirectly diagnosed by serological testing, such
as enzyme-linked immunosorbent assays. A rapid lateral flow assay for LASV nucleoprotein has received a Conformitè Europëenne
(CE) mark that approves the test for use in the European Union,
but it is not approved by the United States Food and Drug Administration (FDA). Each LASV diagnostic assay modality is subject to
limitations, and the timing of specimen collection may influence
the accuracy of testing. Viral yield is highest early in infection and
declines during the second week, which may affect antigen testing
and culture (Johnson et al., 1987). However, the opposite is true
of serological assays, which may yield negative results in the first
week of illness before developing LASV antibodies (Bausch et al.,
20 0 0; Jahrling et al., 1985b; Johnson et al., 1987). The sensitivity of genomic detection through nucleic acid amplification testing
may be decreased if the strain of LASV has a poor match with test
primers (Olschlager et al., 2010). Serologic assays also can experience this challenge. More recently, diagnostic assays using CRISPRCas13a have been developed for LASV infection but are speciesspecific and clade-specific (Barnes et al., 2020). Combinations of
reverse transcription-polymerase chain reaction (PCR) assays with
post-PCR oligonucleotide microarrays for broad viral hemorrhagic
fever diagnostics, including LF, are in development (Olschläger and
Günther, 2012; Yao et al., 2021). Similar to other testing modalities,
nucleic acid testing is more sensitive than rapid lateral flow assays,
particularly when the viral load is lower, as indicated by higher
cycle threshold values by reverse transcription-PCR (Boisen et al.,
2020). The selection of the appropriate diagnostic assay should be
customized based on case management objectives and diagnostic
setting. In some circumstances, using a combination of modalities,
such as viral antigen detection and serological assays, may increase
the diagnostic yield (Bausch et al., 20 0 0).
Testing for LASV may be performed on throat swabs in addition to blood samples. In a study of hospitalized patients, 34%
had positive throat swabs for LASV in the first 12 days of illness,
whereas the virus was only detectable in 13% of samples collected
between days 13 to 24 of illness (Johnson et al., 1987). Detection of LASV in throat swabs is more common among patients
with viremia, but may still be detectable in 14% of patients without viremia (Johnson et al., 1987). The virus that causes LF may
sometimes be detectable in urine samples (Monath et al., 1974).
Among patients with symptoms suggestive of meningitis, the virus
may be detectable in the central nervous system (Johnson et al.,
1987). In cases of suspected LF in the United States, diagnostic testing should be coordinated with local public health officials to arrange for sample evaluation in an appropriate diagnostic facility.
Outside of the United States, the diagnostic testing arrangements
should be coordinated with national, regional, or international reference laboratories in conjunction with appropriate public health
authorities.
Potential Treatment or Prophylaxis Countermeasures
Pre-exposure prophylaxis: Hemorrhagic fevers due to arenaviruses, including LASV, were declared high priority diseases by
the World Health Organization in 2017 (World Health Organization, 2017a). There are currently no licensed vaccines against LASV
infection, although multiple candidates are in clinical development.
Two vaccine candidates, a DNA-based vaccine and a measles virusbased vaccine, have completed phase I studies in humans (ClinicalTrials.gov NCT03805984 and NCT04055454, respectively); however, the results of these vaccine trials are not yet available. A recombinant vesicular stomatitis virus-based vaccine expressing the
LASV glycoprotein, which demonstrated 100% protection against
clinical disease in NHPs, recently entered phase I human clinical trials (ClinicalTrials.gov NCT04794218) (Geisbert et al., 2005,
Marzi et al., 2015; Safronetz et al., 2015). A live attenuated Mopeia
virus-based vaccine known as ML29 also demonstrated 100% protection against symptomatic LF in NHPs and is safe in immunocompromised NHPs. It is anticipated to enter human clinical trials
soon (Lukashevich et al., 2008; Zapata et al., 2013).
Multiple vaccine candidates demonstrate improved survival
from the LASV challenge in NHPs, including the vaccine candidates in human clinical trials. These vaccine candidates encompass
a broad spectrum of platforms, including DNA-based vaccines administered with electroporation, measles virus-vectored vaccines,
Mopeia virus-vectored vaccines, attenuated rabies-vectored vaccines, vaccinia-vectored vaccines, and vesicular stomatitis virusvectored vaccines (Carnec et al., 2018; Cashman et al., 2017;
Cross et al., 2020; Fisher-Hoch et al., 1989; Geisbert et al.,
2005; Jiang et al., 2019; Jiang et al., 2021; Kurup et al., 2021;
Lukashevich et al., 2008; Marzi et al., 2015; Mateo et al., 2019;
Mateo et al., 2021; Safronetz David et al., 2015) (Table 1 ).
Table 2 .
LASV-specific immune responses elicited by these vaccines vary,
even among those that confer a survival benefit. Vaccine-induced
generation of neutralizing antibody and T-cell responses have been
demonstrated for DNA-based, measles virus-vectored, and vesicular
stomatitis virus-vectored vaccines (Cross et al., 2020; Jiang et al.,
2019; Jiang et al., 2021; Mateo et al., 2021). Other vaccine designs,
such as Mopeia virus-vectored vaccines, have been noted to generate predominantly cellular immune responses (Lukashevich et al.,
2005).
Multiple additional vaccine candidates are in pre-clinical development and have demonstrated improved survival or generation of LASV-specific immunogenicity in guinea pig, rabbit, and/or mouse models, but not NHPs, to date. These
include adenovirus-vectored, inactivated rabies virus-vectored,
modified vaccinia Ankara-vectored, single-cycle viral replicon
particle-based, viral-like particle-based, and yellow fever virusvectored vaccines (Abreu-Mota et al., 2018; Branco et al., 2010;
Bredenbeek et al., 2006; Cashman et al., 2013; Fischer et al.,
2021; Goicochea et al., 2012; Jiang et al., 2011; Kainulainen et al.,
2018; Kainulainen Markus H. et al., 2019; Kennedy et al., 2019;
Maruyama et al., 2019; Muller et al., 2020; Salvato et al., 2019;
Wang M. et al., 2018; Wang M. et al., 2021).
Post-exposure prophylaxis: The post-exposure prophylaxis typically considered for individuals with high-risk exposure to LASV is
ribavirin (Bausch et al., 2010). Ribavirin is a guanosine analog with
broad-spectrum antiviral activity. The true effectiveness of ribavirin
as post-exposure prophylaxis has not been calculated, as the rate
of secondary transmission of infection after exposure is unknown.
When used for post-exposure prophylaxis, adverse events such as
changes in mood, dizziness, fatigue, fever, headaches, nausea, and
weakness, are common; therefore, considerations of risks versus
benefits are important (Crowcroft et al., 2004; Hadi et al., 2010;
Isa et al., 2016). Ribavirin should be administered with food as a
190
�Vaccine platform
Manufacturer or
source/contact
Adenovirus vector
DNA vaccine with
electroporation
Human trials
NHP studies
Two vaccine candidates:
1. Adenovirus 5 expressing LASV glycoprotein
2. Adenovirus 5 expressing LASV nucleoprotein
Inovio
Pharmaceuticals
Inactivated rabies
virus vector
191
Measles virus
vector
Description
Two vaccine candidates:
1. Codon-optimized DNA vaccine expressing LASV
glycoprotein
2. Codon-optimized DNA vaccine expressing LASV
glycoprotein complex precursor, Ebola
glycoprotein, and Marburg glycoprotein
Phase I completed,
results not yet
available
[NCT03805984]
NHPs receiving 2 or 3 doses of DNA vaccine
expressing only LASV glycoprotein had 100%
survival and no clinical signs of infection after
LASV challenge (Cashman et al., 2017, Jiang et al.,
2019). Combination LASV, Ebola, and Marburg
DNA vaccine elicits neutralizing antibodies and
T-cell responses in NHPs, although data not yet
available on protection from LASV viral
challenge.(Jiang et al., 2021)
An inactivated, codon-optimized recombinant
rabies-Lassa virus adjuvanted with a TLR-4
agonist
Themis Bioscience
Two vaccine candidates using the Schwarz
measles vaccine platform:
1. Recombinant measles virus expressing LASV
glycoprotein and nucleoprotein
2. Recombinant measles virus expressing LASV
glycoprotein and Z protein
Multiple vaccine candidates:
1. Attenuated recombinant Mopeia virus
(MOPEVAC). expressing LASV glycoprotein
2. Live Mopeia virus
3. Attenuated reassortant Mopeia/Lassa virus
expressing Mopeia virus L protein and LASV S
protein, nucleoprotein, and glycoprotein (ML29)
Rabies virus vector
Multiple vaccine candidates:
1. Attenuated rabies vaccine strain SAD-B19
expressing LASV glycoprotein
2. Tetravalent attenuated rabies vaccine strain
SAD-B19 expressing LASV, Ebola virus, Sudan
virus, and Marburg virus glycoproteins
100% protection against death and clinical
signs of infection among guinea pigs
receiving 2 doses of either vaccine
candidate (Maruyama et al., 2019)
Guinea pigs who received 3 doses of
vaccine did not develop clinical signs of
infection and 100% survived LASV
challenge (Cashman et al., 2013)
100% survival and protection against
clinical signs of infection in guinea pigs
and BALB/c mice, but no protection
against clinical illness or death in BALB/c
Fcγ knockout mice (Abreu-Mota et al.,
2018)
Phase I completed,
results not yet
available
[NCT04055454]
NHPs receiving the candidate expressing LASV
glycoprotein and nucleoprotein occasionally
developed clinical signs of infection after LASV
challenge, although less than control animals,
whereas those receiving the candidate expressing
the LASV glycoprotein and Z protein had
significant clinical illness. All NHPs receiving
either vaccine candidate survived LASV
challenge.(Mateo et al., 2019, Mateo et al., 2021)
MOPEVAC – Clinical signs of infection were
observed after LASV challenge in 1 study but not
another. All NHPs in both studies survived
(Carnec et al., 2018, Mateo et al., 2019)
Live Mopeia virus – No clinical signs of infection
and 100% survival in 2 vaccinated NHPs
challenged with LASV, although both developed
LASV viremia (Fisher-Hoch et al., 1989)
ML29 – No clinical signs of infection and 100%
survival among single-dose NHPs challenged with
LASV (Lukashevich et al., 2008)
ML29 – Guinea pigs who received 1 dose
of vaccine did not develop clinical signs of
infection and had 100% survival after
LASV challenge (Lukashevich et al., 2005).
CBA/J mice receiving 1 dose of vaccine
had 100% survival after LASV challenge
(Goicochea et al., 2012)
IgG antibodies to LASV glycoprotein observed for
both monovalent and tetravalent vaccine
candidates in NHPs (Kurup et al., 2021)
(continued on next page)
International Journal of Infectious Diseases 119 (2022) 187–200
Mopeia virus
vector
Other animal studies
V. Raabe, A.K. Mehta, J.D. Evans et al.
Table 1
Vaccine candidates for Lassa fever
�Vaccine platform
Manufacturer or
source/contact
Viral replicon
particle
Description
Three vaccine candidates:
1. LASV-based single-cycle viral replicon particle
with wild type L and S segments
2. LASV-based single-cycle viral replicon particle
with a nullified nucleoprotein exonuclease on the
S segment
3. Both wild-type LASV glycoprotein genes and a
LASV glycoprotein gene with a C-terminal
deletion substituted for structural genes in a
Venezuelan equine encephalitis viral replicon
particle
Three vaccine candidates:
1. Recombinant New York Board of Health
vaccinia virus expressing LASV glycoprotein
2. Modified Vaccinia Ankara expressing LASV
nucleoprotein
3. Modified Vaccinia Ankara expressing LASV
glycoprotein and Z protein
Vaccinia virus
vector
Human trials
NHP studies
100% protection from clinical signs of
infection and death in guinea pig models
who received 1 dose of any viral-replicon
particle vaccine candidate
(Kainulainen et al., 2018,
Kainulainen M. H. et al., 2019,
Wang M. et al., 2018)
NHPs vaccinated with a single dose of the New
York Board of Health vaccinia virus-based
candidate experienced clinical signs of infection
after LASV challenge and vesicular lesions after
vaccination, but had 100% survival
(Fisher-Hoch et al., 1989)
192
Vesicular
stomatitis virus
vector
Yellow fever virus
vector
Two candidates:
1. Four strains of recombinant vesicular stomatitis
virus combined in 1 vaccine expressing
glycoproteins from 2 Ebola viruses, Marburg
virus, and LASV
2. Recombinant vesicular stomatitis virus with
the LASV glycoprotein inserted in place of the
vesicular stomatitis virus glycoprotein
Two vaccine candidates:
1. Viral-like particles containing LASV
glycoprotein, nucleoprotein, and Z protein
2. Viral-like particles expressing only LASV
glycoprotein adjuvanted with a
squalene-containing water-in-oil adjuvant
Recombinant yellow fever 17D strain expressing
LASV glycoprotein
Combination vaccine - NHPs receiving 2 doses of
vaccine had 100% survival and no clinical signs of
infection after LASV challenge (Cross et al., 2020)
Single strain vaccine – No clinical signs of
infection and 100% survival in NHPs who received
a single vaccine dose (Geisbert et al., 2005,
Marzi et al., 2015)
Guinea pigs immunized with 1 or 2 doses
of the modified Vaccinia Ankara candidate
expressing LASV nucleoprotein had 100%
survival and protection against clinical
signs of infection (Kennedy et al., 2019)
CBA/J mice immunized intramuscularly
with 1 dose of the Vaccinia Ankara
candidate expressing LASV glycoprotein,
and Z protein provided 100% protection
against death from intracerebral challenge
with a Mopeia/Lassa reassortant virus
(Salvato et al., 2019)
Single strain vaccine – No clinical signs of
infection and 100% protection in guinea
pigs receiving a single dose of vaccine
(Safronetz David et al., 2015)
The vaccine candidate containing 3 LASV
proteins is able to generate LASV-specific
IgG antibodies in mice. Efficacy in mice
not yet established (Branco et al., 2010)
The vaccine candidate expressing solely
LASV glycoprotein is able to elicit
neutralizing antibodies to 5 LASV lineages
in rabbits (Muller et al., 2020)
Guinea pigs receiving a single vaccine
dose developed clinical symptoms of
infection on LASV challenge but had
80-83% survival (Bredenbeek et al., 2006,
Jiang et al., 2011)
International Journal of Infectious Diseases 119 (2022) 187–200
Viral-like particle
1. Profectus
Biosciences; 2.
International AIDS
Vaccine Initiative
Other animal studies
V. Raabe, A.K. Mehta, J.D. Evans et al.
Table 1 (continued)
�Treatment
Brand name and
manufacturer or
source/contact
NHP studies
Guanosine
nucleoside analog
McCormick JB, King IJ, Webb PA,
et al.: Lassa fever. Effective therapy
with ribavirin. N Engl J Med. 1986,
314:20-6.
10.1056/NEJM198601023140104
Favipiravir
Favipiravir: MediVector
(USA)
Avigan: Toyama Chemical
(Japan)
Avifavir: ChemRAR Group
(Russia)
Areplivir: Promomed
(Russia)
FabiFlu: Glenmark (India)
Favipira: Beacon
Pharmaceuticals (India)
Generic:
Purine nucleoside
analog
Bausch DG, Hadi CM, Khan SH, Lertora JJ: Review of the
literature and proposed guidelines for the use of oral
ribavirin as post-exposure prophylaxis for Lassa fever. Clin
Infect Dis. 2010, 51:1435-41. 10.1086/657315
Case/Field Studies:
Ilori EA, Furuse Y, Ipadeola OB, et al.: Epidemiologic and
clinical features of Lassa fever outbreak in Nigeria, January
1-May 6, 2018. Emerg Infect Dis. 2019, 25:1066-74.
10.3201/eid2506.181035
Haas WH, Breuer T, Pfaff G, et al.: Imported Lassa fever in
Germany: surveillance and management of contact persons.
Clin Infect Dis. 2003, 36:1254-8. 10.1086/374853
Ajayi NA, Nwigwe CG, Azuogu BN, et al.: Containing a Lassa
fever epidemic in a resource-limited setting: outbreak
description and lessons learned from Abakaliki, Nigeria
(January-March 2012). Int J Infect Dis. 2013, 17:e1011-6.
10.1016/j.ijid.2013.05.015
Shaffer JG, Grant DS, Schieffelin JS, et al.: Lassa fever in
post-conflict Sierra Leone. PLoS Negl Trop Dis. 2014, 8:e2748.
10.1371/journal.pntd.0002748
Buba MI, Dalhat MM, Nguku PM, et al.: Mortality among
confirmed Lassa fever cases during the 2015-2016 outbreak
in Nigeria. Am J Public Health. 2018, 108:262-4.
10.2105/AJPH.2017.304186
Schmitz H, Köhler B, Laue T, et al.: Monitoring of clinical and
laboratory data in 2 cases of imported Lassa fever. Microbes
Infect. 2002, 4:43-50. 10.1016/s1286- 4579(01)01508- 8
Phase I safety trial
NCT04907682
Other animal studies
Rosenke K, Feldmann H, Westover
JB, Hanley PW, Martellaro C,
Feldmann F, et al. Use of
Favipiravir to Treat Lassa Virus
Infection in Macaques. Emerg
Infect Dis 2018;24(9):1696-9.
10.3201/eid2409.180233
(continued on next page)
International Journal of Infectious Diseases 119 (2022) 187–200
Human trials
Copegus: Genentech
Rebetol: Merck Sharp &
Dome
Ribasphere: Kadmon
Pharmaceuticals
Generic: Sandoz
Generic: Teva
193
Description
Ribavirin
V. Raabe, A.K. Mehta, J.D. Evans et al.
Table 2
Therapeutic candidates for Lassa fever
�V. Raabe, A.K. Mehta, J.D. Evans et al.
Table 2 (continued)
Treatment
Brand name and
manufacturer or
source/contact
Ribavirin-Favipiravir
combination
Description
Human trials
Raabe VN, Kann G, Ribner BS, et al.: Favipiravir and ribavirin
treatment of epidemiologically linked cases of Lassa fever.
Clin Infect Dis. 2017, 65:855-9. 10.1093/cid/cix406
Frame JD, Verbrugge GP, Gill RG, Pinneo L: The use of Lassa
fever convalescent plasma in Nigeria. Trans R Soc Trop Med
Hyg. 1984, 78:319-24. 10.1016/0035- 9203(84)90107- x
Jahrling PB, Frame JD, Rhoderick JB, Monson MH. Endemic
Lassa fever in Liberia. IV. Selection of optimally effective
plasma for treatment by passive immunization. Trans R Soc
Trop Med Hyg 1985a;79(3):380-4.
10.1016/0035-9203(85)90388-8
Convalescent plasma
Donors from recovered
infections
Convalescent
plasma
Stampidene
Stampidene: Hughes
Institute and Paradigm
Pharmaceuticals (USA)
Nucleoside reverse
transcriptase
inhibitor
Other animal studies
Mire CE, Cross RW, Geisbert JB,
Borisevich V, Agans KN, Deer DJ, et al.
Human-monoclonal-antibody therapy
protects nonhuman primates against
advanced Lassa fever. Nat Med
2017;23(10):1146-9. 10.1038/nm.4396
Jahrling PB, Peters CJ. Passive antibody
therapy of Lassa fever in cynomolgus
monkeys: importance of neutralizing
antibody and Lassa virus strain. Infect
Immun 1984;44(2):52833.10.1128/iai.44.2.528-533.1984
Jahrling PB, Peters CJ, Stephen EL.
Enhanced treatment of Lassa fever by
immune plasma combined with
ribavirin in cynomolgus monkeys. J
Infect Dis 1984;149(3):420-7.
10.1093/infdis/149.3.420
Uckun FM, Petkevich AS, Vassilev
AO, Tibbles HE, Titov L.
Correction: Stampidine prevents
mortality in an experimental
mouse model of viral hemorrhagic
fever caused by Lassa virus. BMC
Infect Dis. 2004 Jun 1;4:14.
10.1186/1471-2334-4-14
International Journal of Infectious Diseases 119 (2022) 187–200
Arevirumab-3: Zalgen Labs
(USA)
194
Arevirumab-3
Guanosine and
purine nucleoside
analog
Cocktail of 3
monoclonal
antibodies raised
against Lassa fever
virus
NHP studies
�V. Raabe, A.K. Mehta, J.D. Evans et al.
International Journal of Infectious Diseases 119 (2022) 187–200
proposed 10-day course consisting of a 35 mg/kg loading dose followed by 15 mg/kg 3 times daily (Bausch et al., 2010).
ers (Cummins et al., 1991; Frame et al., 1984; McCormick et al.,
1986). Non-human primate data suggest that a combination of ribavirin therapy with convalescent plasma may be more effective
at preventing fatal LF compared with either administered alone
(Jahrling et al., 1984).
Monoclonal antibodies are in development for LF treatment.
A combination of 3 human monoclonal antibodies known as
Arevirumab-3 has been shown to provide protection against lethal
LF disease in NHPs, even when given up to 8 days after infection,
and data suggest that 2 human monoclonal antibody cocktails are
also effective at preventing lethality in NHPs (Mire et al., 2017;
Cross et al., 2019). Based on the efficacy of human monoclonal antibodies for the treatment of LF in NHPs, consideration should be
given to their use in treating human patients with LF.
Treatment
The application of systems of care for sepsis and critical illness
remains the mainstay of LF management, as in other viral hemorrhagic fevers. Patients with LF may experience fluid and electrolyte
imbalances, co-infections, exacerbations of co-morbidities, and secondary organ damage, such as kidney and lung injury, which must
be proactively managed.
Along with post-exposure prophylaxis, ribavirin is also the most
frequently used antiviral medication for treatment of confirmed LF.
Several publications suggest that ribavirin administration within
the first 6 days after the onset of fever and in appropriate care settings may reduce case mortality to as low as 5% (Dahmane et al.,
2014; Jahrling et al., 1984; McCormick et al., 1986). NHP study
data support that the benefit of ribavirin is dependent on treatment initiation early in the course of illness and prolongs survival by reducing the amount of infectious virus (Dahmane et al.,
2014; Jahrling et al., 1980; Jahrling et al., 1984; Lingas et al.,
2021). A recent meta-analysis and retrospective analyses of preexisting datasets suggest that ribavirin reduces mortality for individuals with elevated aspartate aminotransferase levels but is potentially harmful in those without elevated aspartate aminotransferase (Eberhardt et al., 2019; Salam et al., 2021). A retrospective
study of pediatric patients with LF in Sierra Leone did not show
a significant survival benefit associated with ribavirin treatment
(Samuels et al., 2020).
Ribavirin carries a risk of hemolytic anemia, and worsening
anemia has been documented in both humans and NHPs with LF
after treatment (Jahrling et al., 1984; McCormick et al., 1986). In
addition, rigors have been reported among patients with LF treated
with this drug (Fisher-Hoch et al., 1992). Since ribavirin is teratogenic and embryotoxic, the risks of treatment for pregnant and
breastfeeding women should be carefully weighed against potential mortality benefits (Ferm et al., 1978; Kochhar et al., 1980).
Favipiravir (6-fluoro-3-hydroxy-2-pyrazine carboxamide) is an
oral viral RNA polymerase inhibitor that has been licensed for the
treatment of influenza in Japan. Treatment with this antiviral drug
has been shown to improve survival from LASV infection in mice,
guinea pigs, and NHPs and to decrease infectious virus levels in
NHPs (Lingas et al., 2021; Madelain et al., 2020; Oestereich et al.,
2016b; Rosenke et al., 2018; Safronetz D. et al., 2015). A synergistic effect from the combination of ribavirin and favipiravir has also
been observed in mouse models, although data have not shown
improved survival or decreased viremia in NHPs compared with
monotherapy (Madelain et al., 2020; Oestereich et al., 2016b). The
use of the combination of ribavirin and favipiravir for treatment
of LF has been described in 2 individuals, both of whom survived
in the setting of receiving rapid, proactive LF treatment in specialized biocontainment units (Raabe et al., 2017). Similar to ribavirin, favipiravir should be avoided in pregnant and breastfeeding women because of teratogenicity and embryotoxicity in animal
models, along with excretion in breast milk (Nagata et al., 2015).
Convalescent plasma has shown some benefit in improving survival from LF in animal models, including NHPs, but success was
dependent on the dose used and the match of neutralizing antibodies to the LASV strain causing infection (Jahrling et al., 1985a;
Jahrling P B and Peters C J, 1984; Jahrling et al., 1984). Neutralizing antibodies against LASV often take several months to develop after natural infection, indicating that recently recovered individuals may not be suitable for convalescent plasma donation
(Jahrling et al., 1985a). Data from human convalescent treatment
series have shown survival benefits in some studies but not in oth-
Infection Prevention and Control Recommendations
Patients with LASV infection should optimally be managed
in a biocontainment unit to prevent secondary person-to-person
spread using appropriate infection control measures because of
the high degree of mortality associated with infection. To date,
secondary transmission of LASV infection from cases cared for
in non-endemic countries remains low, although cases among
health care workers have been reported during LASV outbreaks
in Africa (Grahn et al., 2018; Ilori et al., 2019; Kraft et al., 2020;
Lehmann et al., 2017; Raabe et al., 2017; Wolf et al., 2020).
When available, the patient should be placed in a singlepatient room containing private bathroom facilities. Negative
pressure should be used, when available, to facilitate the safe
performance of aerosol-generating procedures if clinically indicated. Liquid waste management needs may be high as
these patients can produce high volumes of stool. Access to
the patient room should be regulated, restricting contact to
only approved health care personnel using appropriate personal protective equipment for contact and droplet precautions.
Personal protective equipment used for Lassa patient management is similar to that recommended for Ebola (https://www.
who.int/publications/i/item/WHO- HIS- SDS- 2014.4- Rev.1,
https:
//www.who.int/publications/i/item/9789241549608, and https:
//assets.publishing.service.gov.uk/government/uploads/system/
uploads/attachment_data/file/534002/Management_of_VHF_A.pdf).
It should include 2 pairs of gloves, a fluid-resistant, disposable gown or coverall, a waterproof apron, head, and neck
coverings, a face mask or respirator, eye protection, and waterproof boots/shoe covers. Airborne precautions should be
used if procedures that generate aerosols are anticipated to be
performed, including using a respirator. Donning and doffing
protocols for personal protective equipment should be used to
minimize the risk of contamination, and frequent hand hygiene
should be performed. When possible, using sharps and aerosolgenerating procedures should be avoided; appropriate sharps
disposal units should be readily accessible in the patient room.
Guidelines developed for the management of other viral hemorrhagic fever infections such as Ebola virus disease, available at
https://www.who.int/publications/i/item/9789241549608,
https:
//assets.publishing.service.gov.uk/government/uploads/system/
uploads/attachment_data/file/534002/Management_of_VHF_A.pdf,
and https://www.cdc.gov/vhf/ebola/clinicians/evd/infection-control.
html, are appropriate for use in managing patients with LASV
infection. Procedures involving potential exposures to body fluids,
such as phlebotomy, should be coordinated to provide appropriate diagnostic and therapeutic management with the minimum
number of potentially high-risk interventions.
Appropriate protective equipment should be used by laboratory workers performing diagnostic assays on samples collected
from patients with suspected LASV infections, including using
195
�V. Raabe, A.K. Mehta, J.D. Evans et al.
International Journal of Infectious Diseases 119 (2022) 187–200
a fluid-resistant or fluid-impermeable disposable gown, masks,
or respirators, and eye protection. Biosafety class II or I cabinets
should be used to perform laboratory assays when available.
The risks of each procedure to generate aerosols should be
assessed and the use of N95-respirators considered if procedures generating aerosols cannot be avoided. Safety measures
such as the use of sealed containers or closed tube systems
should be used when possible to maximize laboratory safety.
Plans should be developed for the appropriate decontamination of equipment after use. Laboratory guidance developed for
viral hemorrhagic fevers (https://www.who.int/publications/i/
item/WHO- HIS- SDS- 2014.4- Rev.1, https://www.cdc.gov/vhf/ebola/
laboratory- personnel/safe- specimen- management.html, and https:
//assets.publishing.service.gov.uk/government/uploads/system/
uploads/attachment_data/file/534002/Management_of_VHF_A.pdf)
is appropriate for use with samples from patients with LASV
infection. Autopsies should not routinely be performed because
of transmission risk. If necessary, autopsies on patients with LF
should only be performed at designated centers with experience
using appropriate infection control precautions for performing
high-risk autopsies.
African wood mouse (Hylomyscus pamfi), the Guinea multimammate mouse (Mastomys erythroleucus), the typical striped grass
mouse (Lemniscomys striatus), Dalton’s mouse (Praomys daltoni),
Forest soft-furred mouse (Praomys rostratus), Misonne’s soft-furred
mouse (Praomys misonnei), the African pygmy mouse (Mus minutoides), Baoule’s mouse (Mus baoulei), the black rat (Rattus rattus),
and some shrew species (Crocidura species) (Fichet-Calvet et al.,
2014; Olayemi et al., 2016; Olayemi et al., 2018; Yadouleton et al.,
2019). A meta-analysis suggests the prevalence of LASV infection is
3.2% among various rodents in West Africa (Kenmoe et al., 2020).
LASV genetic material was detectable in 10 of 88 rodent dropping
samples collected from 3 villages in Guinea (Wood et al., 2021).
Transmission: Most human LASV infections occur through
transmission from rodent reservoirs by direct contact or exposure to rodent excreta rather than human-to-human transmission, although human super-spreader events have been described
(Andersen et al., 2015; Kafetzopoulou et al., 2019; Lo Iacono et al.,
2015). Although direct inoculation may occur as a result of a bite
or scratch, indirect inoculation is believed to be more common.
LASV is shed in rodent excreta and humans may become infected
by inhaling aerosolized excreta or ingesting rodent-contaminated
food items. Most human infections are reported during the dry
season (Bausch et al., 2001; Redding et al., 2021). Human-tohuman transmission can occur after exposure to blood, tissue, secretions, or excretions of an infected individual or through contaminated equipment (Fisher-Hoch et al., 1995). The virus can be
detected in genital fluids, although it is unknown whether infection can occur through sexual contact with an infected or recently
infected individual (Raabe et al., 2017). The estimated basic reproduction number (R0 ) of LF varies between 1.1 to 1.8 (Wang J. et al.,
2021).
Human infections: Symptomatic disease after infection with
LASV is known as LF, which is endemic in parts of western and
central Africa, in particular in rural forested regions. Studies have
estimated that there are 10 0,0 0 0 to 50 0,0 0 0 cases of LF in Africa
per year, with approximately 5,0 0 0 to 10,0 0 0 deaths (Asogun et al.,
2019; McCormick, 1987). Other models predict that nearly 90 0,0 0 0
humans are infected with LASV annually (Basinski et al., 2021).
One older study in Sierra Leone demonstrated that in 1 area,
10%-16% of all hospital admissions were associated with LF, indicating a significant health care burden in high-incidence regions
(McCormick et al., 1987a). Seroprevalence studies in focused communities have found seropositivity rates as high as 52% in Sierra
Leone, 55% in Guinea, and 21% in Nigeria (Lukashevich et al., 1993;
McCormick et al., 1987b; Tomori et al., 1988). A recent metaanalysis suggested the overall prevalence of LASV seropositivity to
be 8.7% among humans in sub-Saharan Africa with a higher prevalence of 11.1%-19.6% among health care workers (Kenmoe et al.,
2020; Shaibu et al., 2021). At least 37 primary cases of LF associated with international travel, which led to 4 secondary instances of transmission among non-travelers, have been reported
in non-endemic countries (Wolf et al., 2020; World Health Organization, 2022).
Summary and Recommendations
LF remains a persistent public health threat in West Africa. Although difficult to distinguish from other etiologies of febrile illnesses on clinical symptoms alone, various testing options are now
available to aid with the diagnosis of infection. Multiple promising
vaccines are in development for prevention, although still in the
early stages of human clinical trials, and none are currently approved for use.
As with other viral hemorrhagic fevers, applying systems of care
appropriate to critically ill patient management remains the mainstay of treatment of LF. Early initiation of antiviral therapeutics
may confer some survival benefits. Historically, ribavirin has been
the mainstay of antiviral therapy for LASV infections. A newer antiviral medication, favipiravir, shows potential benefit in animals
and has been combined with ribavirin therapy to treat 2 human
cases of LF. Studies of convalescent plasma have shown mixed results, which may relate to varying amounts of neutralizing antibodies present. Monoclonal antibody therapy for LASV infection is
in development, and early data from NHP studies show promising
results for preventing death from LF.
Boxes (to consider for inside the article as a separate online
resource)
Box 1: The Pathogen
Lassa fever is a viral hemorrhagic fever pathogen classified as
a member of the Bunyavirales order of viruses in the family Arenaviridae, genus Mammarenavirus. The enveloped virion particle
contains 2 single-stranded RNA segments that encode 4 proteins
through ambisense transcription (Lukashevich et al., 1984). LASV
strains demonstrate significant genetic diversity, with variations of
up to 32% at a nucleotide level in the L RNA strand and 25% in the
S RNA strand (Andersen et al., 2015; Bowen et al., 20 0 0). LASVs
fall into 7 confirmed genetic lineages (Forni and Sironi, 2020;
Ibukun, 2020; Manning et al., 2015; Whitmer et al., 2018).
Conflict of Interest
No potential author conflicts of interest are noted.
Funding
Box 2: Epidemiology
Research reported in this publication was supported by the Department of Health and Human Services Office of the Assistant
Secretary for Preparedness and Response under award number 5
U3REP170552-003-02.
Animal hosts: The main reservoir of LASV is Mastomys natalensis, the natal multimammate mouse (Demby et al., 2001). Other
rodents have been identified as carrying the virus, including the
196
�V. Raabe, A.K. Mehta, J.D. Evans et al.
International Journal of Infectious Diseases 119 (2022) 187–200
Disclaimers
Carnec X, Baize S, Reynard S, Diancourt L, Caro V, Tordo N, et al. Lassa virus nucleoprotein mutants generated by reverse genetics induce a robust type I interferon response in human dendritic cells and macrophages. Journal of virology 2011;85(22):12093–7; Carnec X, Mateo M, Page A, Reynard S, Hortion J,
Picard C, et al. A vaccine platform against arenaviruses nased on a recombinant hyperattenuated Mopeia virus expressing heterologous glycoproteins. J Virol 2018;92(12).
Cashman KA, Broderick KE, Wilkinson ER, Shaia CI, Bell TM, Shurtleff AC, et al. Enhanced efficacy of a codon-optimized DNA vaccine encoding the glycoprotein
precursor gene of Lassa virus in a guinea pig disease model when delivered by
dermal electroporation. Vaccines (Basel) 2013;1(3):262–77.
Cashman KA, Wilkinson ER, Shaia CI, Facemire PR, Bell TM, Bearss JJ, et al. A
DNA vaccine delivered by dermal electroporation fully protects cynomolgus
macaques against Lassa fever. Hum Vaccines Immunother 2017;13(12):2902–11.
Chang PC, Chi CW, Chau GY, Li FY, Tsai YH, Wu JC, et al. DDX3, a DEAD box RNA
helicase, is deregulated in hepatitis virus-associated hepatocellular carcinoma
and is involved in cell growth control. Oncogene 2006;25(14):1991–2003.
Cross RW, Hastie KM, Mire CE, Robinson JE, Geisbert TW, Branco LM, et al. Antibody
therapy for Lassa fever. Current Opinion in Virology 2019;37:97–104.
Cross RW, Xu R, Matassov D, Hamm S, Latham TE, Gerardi CS, et al. Quadrivalent
VesiculoVax vaccine protects nonhuman primates from viral-induced hemorrhagic fever and death. J Clin Invest 2020;130(1):539–51.
Crowcroft NS, Meltzer M, Evans M, Shetty N, Maguire H, Bahl M, et al. The
public health response to a case of Lassa fever in London in 20 0 0. J Infect
2004;48(3):221–8.
Cummins D, Bennett D, Fisher-Hoch SP, Farrar B, Machin SJ, McCormick JB.
Lassa fever encephalopathy: clinical and laboratory findings. J Trop Med Hyg
1992;95(3):197–201.
Cummins D, Bennett D, Machin SJ. Exchange transfusion of a patient with fulminant
Lassa fever. Postgrad Med J 1991;67(784):193–4.
Cummins D, McCormick JB, Bennett D, Samba JA, Farrar B, Machin SJ, et al. Acute
sensorineural deafness in Lassa fever. JAMA 1990;264(16):2093–6.
Dahmane A, van Griensven J, Van Herp M, Van den Bergh R, Nzomukunda Y, Prior J,
et al. Constraints in the diagnosis and treatment of Lassa Fever and the effect on mortality in hospitalized children and women with obstetric conditions in a rural district hospital in Sierra Leone. Trans R Soc Trop Med Hyg
2014;108(3):126–32.
Demby AH, Inapogui A, Kargbo K, Koninga J, Kourouma K, Kanu J, et al. Lassa fever
in Guinea: II. Distribution and prevalence of Lassa virus infection in small mammals. Vector Borne Zoonotic Dis 2001;1(4):283–97.
Duvignaud A, Doutchi M, Abejegah C, Etafo I, Jaspard M, Serra B, et al. Delayed-onset paraparesis in Lassa fever: A case report. Int J Infect Dis 2020;92:49–52.
Duvignaud A, Jaspard M, Etafo IC, Gabillard D, Serra B, Abejegah C, et al. Lassa
fever outcomes and prognostic factors in Nigeria (LASCOPE): a prospective cohort study. Lancet Glob Health 2021;9(4):E469–EE78.
Eberhardt KA, Mischlinger J, Jordan S, Groger M, Gunther S, Ramharter M. Ribavirin
for the treatment of Lassa fever: A systematic review and meta-analysis. Int J
Infect Dis 2019;87:15–20.
Edington GM, White HA. The pathology of Lassa fever. Trans R Soc Trop Med Hyg
1972;66(3):381–9.
Ehichioya DU, Dellicour S, Pahlmann M, Rieger T, Oestereich L, Becker-Ziaja B, et al.
Phylogeography of Lassa virus in Nigeria. Journal of virology 2019;93(21).
Ezeomah C, Adoga A, Ihekweazu C, Paessler S, Cisneros I, Tomori O, et al. Sequelae of Lassa fever: Postviral cerebellar ataxia. Open Forum Infect Dis
2019;6(12):ofz512.
Fedeli C, Torriani G, Galan-Navarro C, Moraz ML, Moreno H, Gerold G, et al. Axl Can
Serve as Entry Factor for Lassa Virus Depending on the Functional Glycosylation
of Dystroglycan. J Virol 2018;92(5).
Ferm VH, Willhite C, Kilham L. Teratogenic effects of ribavirin on hamster and rat
embryos. Teratology 1978;17(1):93–101.
Ficenec SC, Percak J, Arguello S, Bays A, Goba A, Gbakie M, et al. Lassa fever induced hearing loss: The neglected disability of hemorrhagic fever. Int J Infect
Dis 2020;100:82–7.
Fichet-Calvet E, Becker-Ziaja B, Koivogui L, Günther S. Lassa serology in natural
populations of rodents and horizontal transmission. Vector Borne Zoonotic Dis
2014;14(9):665–74.
Fischer RJ, Purushotham JN, van Doremalen N, Sebastian S, Meade-White K, Cordova K, et al. ChAdOx1-vectored Lassa fever vaccine elicits a robust cellular and
humoral immune response and protects guinea pigs against lethal Lassa virus
challenge. NPJ vaccines 2021;6(1):32.
Fisher-Hoch S, McCormick JB, Sasso D, Craven RB. Hematologic dysfunction in Lassa
fever. J Med Virol 1988;26(2):127–35.
Fisher-Hoch SP, Gborie S, Parker L, Huggins J. Unexpected adverse reactions during
a clinical trial in rural West Africa. Antiviral Res 1992;19(2):139–47.
Fisher-Hoch SP, McCormick JB. Pathophysiology and treatment of Lassa fever. Curr
Top Microbiol Immunol 1987;134:231–9.
Fisher-Hoch SP, McCormick JB, Auperin D, Brown BG, Castor M, Perez G, et al. Protection of rhesus monkeys from fatal Lassa fever by vaccination with a recombinant vaccinia virus containing the Lassa virus glycoprotein gene. Proc Natl Acad
Sci U S A 1989;86(1):317–21.
Fisher-Hoch SP, Tomori O, Nasidi A, Perez-Oronoz GI, Fakile Y, Hutwagner L, et al.
Review of cases of nosocomial Lassa fever in Nigeria: the high price of poor
medical practice. BMJ 1995;311(7009):857–9.
Flatz L, Rieger T, Merkler D, Bergthaler A, Regen T, Schedensack M, et al. T cell-dependence of Lassa fever pathogenesis. PLoS pathogens 2010;6(3) -e.
The content and views expressed in this manuscript are the responsibility of the authors and do not necessarily represent the official views of the Department of Health and Human Services Office of the Assistant Secretary for Preparedness and Response or
the Department of Defense, nor are they intended to represent the
views of the authors’ individual institutions.
Ethical Approval
The work described herein was solely a review of the literature
and, as such, did not need Institutional Review Board or Animal
Use Committee approvals.
REFERENCES
Abreu-Mota T, Hagen KR, Cooper K, Jahrling PB, Tan G, Wirblich C, et al. Non-neutralizing antibodies elicited by recombinant Lassa-Rabies vaccine are critical for
protection against Lassa fever. Nat Commun 2018;9(1):4223.
Adetunji AE, Ayenale M, Akhigbe I, Akerele LO, Isibor E, Idialu J, et al. Acute kidney injury and mortality in pediatric Lassa fever versus question of access to
dialysis. Int J Infect Dis 2021;103:124–31.
Andersen KG, Shapiro BJ, Matranga CB, Sealfon R, Lin AE, Moses LM, et al.
Clinical sequencing uncovers origins and evolution of Lassa virus. Cell
2015;162(4):738–50.
Andrei G, De Clercq E. Inhibitory effect of selected antiviral compounds on arenavirus replication in vitro. Antiviral Res 1990;14(4-5):287–99.
Asogun DA, Adomeh DI, Ehimuan J, Odia I, Hass M, Gabriel M, et al. Molecular diagnostics for lassa fever at Irrua specialist teaching hospital, Nigeria:
lessons learnt from two years of laboratory operation. PLoS Negl Trop Dis
2012;6(9):e1839.
Asogun DA, Gunther S, Akpede GO, Ihekweazu C, Zumla A. Lassa fever: Epidemiology, clinical features, diagnosis, management and prevention. Infect Dis Clin
North Am 2019;33(4):933–51.
Baize S, Marianneau P, Loth P, Reynard S, Journeaux A, Chevallier M, et al.
Early and strong immune responses are associated with control of viral
replication and recovery in lassa virus-infected cynomolgus monkeys. J Virol
2009;83(11):5890–903.
Baize S, Pannetier D, Faure C, Marianneau P, Marendat I, MC Georges-Courbot, et al.
Role of interferons in the control of Lassa virus replication in human dendritic
cells and macrophages. Microbes Infect 2006;8(5):1194–202.
Barnes KG, Lachenauer AE, Nitido A, Siddiqui S, Gross R, Beitzel B, et al. Deployable
CRISPR-Cas13a diagnostic tools to detect and report Ebola and Lassa virus cases
in real-time. Nat Commun 2020;11(1):4131.
Basinski AJ, Fichet-Calvet E, Sjodin AR, Varrelman TJ, Remien CH, Layman NC, et al.
Bridging the gap: Using reservoir ecology and human serosurveys to estimate
Lassa virus spillover in West Africa. PLoS Comput Biol 2021;17(3).
Bausch DG, Demby AH, Coulibaly M, Kanu J, Goba A, Bah A, et al. Lassa fever
in Guinea: I. Epidemiology of human disease and clinical observations. Vector
Borne Zoonotic Dis 2001;1(4):269–81.
Bausch DG, Hadi CM, Khan SH, Lertora JJ. Review of the literature and proposed
guidelines for the use of oral ribavirin as postexposure prophylaxis for Lassa
fever. Clin Infect Dis 2010;51(12):1435–41.
Bausch DG, Rollin PE, Demby AH, Coulibaly M, Kanu J, Conteh AS, et al. Diagnosis
and clinical virology of Lassa fever as evaluated by enzyme-linked immunosorbent assay, indirect fluorescent-antibody test, and virus isolation. J Clin Microbiol 20 0 0;38(7):2670–7.
Boisen ML, Uyigue E, Aiyepada J, Siddle KJ, Oestereich L, Nelson DKS, et al. Field
evaluation of a Pan-Lassa rapid diagnostic test during the 2018 Nigerian Lassa
fever outbreak. Sci Rep 2020;10(1):8724.
Bowen MD, Rollin PE, Ksiazek TG, Hustad HL, Bausch DG, Demby AH, et al. Genetic
diversity among Lassa virus strains. J Virol 20 0 0;74(15):6992–7004.
Branco LM, Grove JN, Geske FJ, Boisen ML, Muncy IJ, Magliato SA, et al. Lassa virus–
like particles displaying all major immunological determinants as a vaccine candidate for Lassa hemorrhagic fever. Virol J 2010;7:279.
Bredenbeek PJ, Molenkamp R, Spaan WJ, Deubel V, Marianneau P, Salvato MS, et al.
A recombinant Yellow Fever 17D vaccine expressing Lassa virus glycoproteins.
Virol J 2006;345(2):299–304.
Brouillette RB, Phillips EK, Patel R, Mahauad-Fernandez W, Moller-Tank S, Rogers KJ,
et al. TIM-1 Mediates Dystroglycan-Independent Entry of Lassa Virus. J Virol
2018;92(16).
Callis RT, Jahrling PB, DePaoli A. Pathology of Lassa virus infection in the rhesus
monkey. Am J Trop Med Hyg 1982;31(5):1038–45.
Cao W, Henry MD, Borrow P, Yamada H, Elder JH, Ravkov EV, et al. Identification
of alpha-dystroglycan as a receptor for lymphocytic choriomeningitis virus and
Lassa fever virus. Science 1998;282(5396):2079–81.
197
�V. Raabe, A.K. Mehta, J.D. Evans et al.
International Journal of Infectious Diseases 119 (2022) 187–200
Forni D, Sironi M. Population structure of Lassa mammarenavirus in West Africa.
Viruses 2020;12(4):437.
Frame JD, Baldwin Jr JM, Gocke DJ, Troup JM. Lassa fever, a new virus disease of
man from West Africa. I. Clinical description and pathological findings. Am J
Trop Med Hyg 1970;19(4):670–6.
Frame JD, Verbrugge GP, Gill RG, Pinneo L. The use of Lassa fever convalescent
plasma in Nigeria. Trans R Soc Trop Med Hyg 1984;78(3):319–24.
Frank MG, Beitscher A, Webb CM. Raabe V, members of the Medical Countermeasures Working Group of the National Emerging Special Pathogens T, Education
Center’s Special Pathogens Research N. South American Hemorrhagic Fevers: A
summary for clinicians. Int J Infect Dis 2021;105:505–15.
Geisbert TW, Jones S, Fritz EA, Shurtleff AC, Geisbert JB, Liebscher R, et al. Development of a new vaccine for the prevention of Lassa fever. PLoS Med
2005;2(6):e183.
Goicochea MA, Zapata JC, Bryant J, Davis H, Salvato MS, Lukashevich IS. Evaluation
of Lassa virus vaccine immunogenicity in a CBA/J-ML29 mouse model. Vaccine
2012;30(8):1445–52.
Grahn A, Brave A, Tolfvenstam T, Studahl M. Absence of nosocomial transmission
of imported Lassa fever during use of standard barrier nursing methods. Emerg
Infect Dis 2018;24(6):978–87.
Gunther S, Weisner B, Roth A, Grewing T, Asper M, Drosten C, et al. Lassa fever
encephalopathy: Lassa virus in cerebrospinal fluid but not in serum. J Infect Dis
2001;184(3):345–9.
Hadi CM, Goba A, Khan SH, Bangura J, Sankoh M, Koroma S, et al. Ribavirin for Lassa
fever postexposure prophylaxis. Emerg Infect Dis 2010;16(12):2009–11.
Happi AN, Happi CT, Schoepp RJ. Lassa fever diagnostics: Past, present, and future.
Curr Opin Virol 2019;37:132–8.
Hastie KM, Kimberlin CR, Zandonatti MA, MacRae IJ, Saphire EO. Structure of
the Lassa virus nucleoprotein reveals a dsRNA-specific 3� to 5� exonuclease activity essential for immune suppression. Proc Natl Acad Sci U S A
2011;108(6):2396–401.
Hastie KM, King LB, Zandonatti MA, Saphire EO. Structural basis for the dsRNA
specificity of the Lassa virus NP exonuclease. PLoS One 2012;7(8):e44211.
Hensley LE, Smith MA, Geisbert JB, Fritz EA, Daddario-DiCaprio KM, Larsen T, et al.
Pathogenesis of Lassa fever in cynomolgus macaques. Virol J 2011;8:205.
Herrador A, Fedeli C, Radulovic E, Campbell KP, Moreno H, Gerold G, et al. Dynamic
Dystroglycan Complexes Mediate Cell Entry of Lassa Virus. mBio 2019;10(2).
Herring S, Oda JM, Wagoner J, Kirchmeier D, O’Connor A, Nelson EA, et al. Inhibition
of arenaviruses by combinations of orally available approved drugs. Antimicrob
Agents Chemother 2021;65(4).
Huang Q, Liu X, Brisse M, Ly H, Liang Y. Effect of strain variations on Lassa virus Z
protein-mediated human RIG-I inhibition. Viruses 2020;12(9).
Hulseberg CE, Fénéant L, Szymańska-de Wijs KM, Kessler NP, Nelson EA, Shoemaker CJ, et al. Arbidol and other low-molecular-weight drugs that inhibit Lassa
and Ebola viruses. J Virol 2019;93(8).
Huynh T, Gary JM, Welch SR, Coleman-McCray J, Harmon JR, Kainulainen MH, et al.
Lassa virus antigen distribution and inflammation in the ear of infected strain
13/N Guinea pigs. Antiviral Res 2020;183.
Ibekwe TS, Okokhere PO, Asogun D, Blackie FF, Nwegbu MM, Wahab KW, et al.
Early-onset sensorineural hearing loss in Lassa fever. Eur Arch Otorhinolaryngol 2011;268(2):197–201.
Ibukun FI. Inter-lineage variation of Lassa virus glycoprotein epitopes: A challenge
to Lassa virus vaccine development. Viruses 2020;12(4).
Ilori EA, Furuse Y, Ipadeola OB, Dan-Nwafor CC, Abubakar A, Womi-Eteng OE, et al.
Epidemiologic and clinical features of Lassa fever outbreak in Nigeria, January
1-May 6, 2018. Emerg Infect Dis 2019;25(6):1066–74.
Ipadeola O, Furuse Y, Ilori EA, Dan-Nwafor CC, Akabike KO, Ahumibe A, et al. Epidemiology and case-control study of Lassa fever outbreak in Nigeria from 2018
to 2019. J Infect 2020;80(5):578–606.
Isa SE, Okwute A, Iraoyah KO, Nathan SY, Simji GS, Okolo MO, et al. Postexposure
prophylaxis for Lassa fever: Experience from a recent outbreak in Nigeria. Niger
Med J 2016;57(4):246–50.
Israeli H, Cohen-Dvashi H, Shulman A, Shimon A, Diskin R. Mapping of the Lassa
virus LAMP1 binding site reveals unique determinants not shared by other old
world arenaviruses. PLoS Pathog 2017;13(4).
Jae LT, Raaben M, Herbert AS, Kuehne AI, Wirchnianski AS, Soh TK, et al.
Lassa virus entry requires a trigger-induced receptor switch. Science
2014;344(6191):1506–10.
Jahrling PB, Frame JD, Rhoderick JB, Monson MH. Endemic Lassa fever in Liberia. IV.
Selection of optimally effective plasma for treatment by passive immunization.
Trans R Soc Trop Med Hyg 1985a;79(3):380–4.
Jahrling PB, Hesse RA, Eddy GA, Johnson KM, Callis RT, Stephen EL. Lassa virus infection of rhesus monkeys: pathogenesis and treatment with ribavirin. J Infect
Dis 1980;141(5):580–9.
Jahrling PB, Niklasson BS, McCormick JB. Early diagnosis of human Lassa fever by
ELISA detection of antigen and antibody. Lancet 1985b;1(8423):250–2.
Jahrling PB, Peters CJ. Passive antibody therapy of Lassa fever in cynomolgus monkeys: importance of neutralizing antibody and Lassa virus strain. Infect Immun
1984;44(2):528–33.
Jahrling PB, Peters CJ, Stephen EL. Enhanced treatment of Lassa fever by immune plasma combined with ribavirin in cynomolgus monkeys. J Infect Dis
1984;149(3):420–7.
Jeffs B. A clinical guide to viral haemorrhagic fevers: Ebola, Marburg and Lassa. Trop
Doct 2006;36(1):1–4.
Jiang J, Banglore P, Cashman KA, Schmaljohn CS, Schultheis K, Pugh H, et al. Immunogenicity of a protective intradermal DNA vaccine against lassa virus in
cynomolgus macaques. Hum Vaccin Immunother 2019;15(9):2066–74.
Jiang J, Ramos SJ, Bangalore P, Elwood D, Cashman KA, Kudchodkar SB, et al. Multivalent DNA vaccines as a strategy to combat multiple concurrent epidemics:
Mosquito-borne and hemorrhagic fever viruses. Viruses 2021;13(3).
Jiang X, Dalebout TJ, Bredenbeek PJ, Carrion Jr R, Brasky K, Patterson J, et al.
Yellow fever 17D-vectored vaccines expressing Lassa virus GP1 and GP2 glycoproteins provide protection against fatal disease in guinea pigs. Vaccine
2011;29(6):1248–57.
Jiang X, Huang Q, Wang W, Dong H, Ly H, Liang Y, et al. Structures of arenaviral
nucleoproteins with triphosphate dsRNA reveal a unique mechanism of immune
suppression. J Biol Chem 2013;288(23):16949–59.
Johnson KM, McCormick JB, Webb PA, Smith ES, Elliott LH, King IJ. Clinical virology
of Lassa fever in hospitalized patients. J Infect Dis 1987;155(3):456–64.
Kafetzopoulou LE, Pullan ST, Lemey P, Suchard MA, Ehichioya DU, Pahlmann M,
et al. Metagenomic sequencing at the epicenter of the Nigeria 2018 Lassa fever
outbreak. Science 2019;363(6422):74–7.
Kainulainen MH, Spengler JR, Welch SR, Coleman-McCray JD, Harmon JR, Klena JD,
et al. Use of a scalable replicon-particle vaccine to protect against lethal Lassa
virus infection in the guinea pig model. J Infect Dis 2018;217(12):1957–66.
Kainulainen MH, Spengler JR, Welch SR, Coleman-McCray JD, Harmon JR,
Scholte FEM, et al. Protection from lethal Lassa disease can be achieved both before and after virus exposure by administration of single-cycle replicating Lassa
virus replicon particles. J Infect Dis 2019;220(8):1281–9.
Kainulainen MH, Spengler JR, Welch SR, Coleman-McCray JD, Harmon JR,
Scholte FEM, et al. Protection From Lethal Lassa Disease Can Be Achieved Both
Before and After Virus Exposure by Administration of Single-Cycle Replicating
Lassa Virus Replicon Particles. J Infect Dis 2019;220(8):1281–9.
Kayem ND, Benson C, Aye CYL, Barker S, Tome M, Kennedy S, et al. Lassa fever in
pregnancy: a systematic review and meta-analysis. Trans R Soc Trop Med Hyg
2020;114(5):385–96.
Kenmoe S, Tchatchouang S, Ebogo-Belobo JT, Ka’e AC, Mahamat G, Guiamdjo
Simo RE, et al. Systematic review and meta-analysis of the epidemiology of
Lassa virus in humans, rodents and other mammals in sub-Saharan Africa. PLoS
Negl Trop Dis 2020;14(8).
Kennedy EM, Dowall SD, Salguero FJ, Yeates P, Aram M, Hewson R. A vaccine based
on recombinant modified Vaccinia Ankara containing the nucleoprotein from
Lassa virus protects against disease progression in a guinea pig model. Vaccine
2019;37(36):5404–13.
Klitting R, Mehta SB, Oguzie JU, Oluniyi PE, Pauthner MG, Siddle KJ, et al. Lassa virus
genetics. Curr Top Microbiol Immunol 2020.
Kochhar DM, Penner JD, Knudsen TB. Embryotoxic, teratogenic, and metabolic effects of ribavirin in mice. Toxicol Appl Pharmacol 1980;52(1):99–112.
Kortepeter MG, Dierberg K, Shenoy ES, Cieslak TJ. Medical Countermeasures Working Group of the National Ebola T, Education Center’s Special Pathogens Research N. Marburg virus disease: A summary for clinicians. Int J Infect Dis
2020;99:233–42.
Kraft CS, Mehta AK, Varkey JB, Lyon GM, Vanairsdale S, Bell S, et al. Serosurvey
on healthcare personnel caring for patients with Ebola virus disease and Lassa
virus in the United States. Infect Control Hosp Epidemiol 2020;41(4):385–90.
Kurup D, Fisher CR, Scher G, Yankowski C, Testa A, Keshwara R, et al. Tetravalent
Rabies-vectored filovirus and Lassa fever vaccine induces long-term immunity
in nonhuman primates. J Infect Dis 2021;224(6):995–1004.
Lai MC, Chang WC, Shieh SY, Tarn WY. DDX3 regulates cell growth through translational control of cyclin E1. Mol Cell Biol 2010;30(22):5444–53.
Lee AM, Pasquato A, Kunz S. Novel approaches in anti-arenaviral drug development.
Virology 2011;411(2):163–9.
Lehmann C, Kochanek M, Abdulla D, Becker S, Boll B, Bunte A, et al. Control measures following a case of imported Lassa fever from Togo, North Rhine Westphalia, Germany, 2016. Euro Surveill 2017;22(39).
Li AL, Grant D, Gbakie M, Kanneh L, Mustafa I, Bond N, et al. Ophthalmic manifestations and vision impairment in Lassa fever survivors. PLoS One 2020;15(12).
Li S, Sun Z, Pryce R, Parsy ML, Fehling SK, Schlie K, et al. Acidic pH-induced conformations and LAMP1 binding of the Lassa virus glycoprotein spike. PLoS Pathog
2016;12(2).
Lingas G, Rosenke K, Safronetz D, Guedj J. Lassa viral dynamics in non-human primates treated with favipiravir or ribavirin. PLoS Comput Biol 2021;17(1).
Lo Iacono G, Cunningham AA, Fichet-Calvet E, Garry RF, Grant DS, Khan SH,
et al. Using modelling to disentangle the relative contributions of zoonotic
and anthroponotic transmission: the case of lassa fever. PLoS Negl Trop Dis
2015;9(1):e3398.
Loureiro ME, D’Antuono A, Levingston Macleod JM, López N. Uncovering viral
protein-protein interactions and their role in arenavirus life cycle. Viruses
2012;4(9):1651–67.
Loureiro ME, D’Antuono A, López N. Virus-host interactions involved in Lassa virus
entry and genome replication. Pathogens (Basel, Switzerland) 2019;8(1).
Loureiro ME, Zorzetto-Fernandes AL, Radoshitzky S, Chi X, Dallari S, Marooki N,
et al. DDX3 suppresses type I interferons and favors viral replication during arenavirus infection. PLoS pathogens 2018;14(7).
Lukashevich IS, Carrion Jr R, Salvato MS, Mansfield K, Brasky K, Zapata J, et al.
Safety, immunogenicity, and efficacy of the ML29 reassortant vaccine for Lassa
fever in small non-human primates. Vaccine 2008;26(41):5246–54.
Lukashevich IS, Clegg JC, Sidibe K. Lassa virus activity in Guinea: distribution of
human antiviral antibody defined using enzyme-linked immunosorbent assay
with recombinant antigen. J Med Virol 1993;40(3):210–17.
Lukashevich IS, Patterson J, Carrion R, Moshkoff D, Ticer A, Zapata J, et al. A live
attenuated vaccine for Lassa fever made by reassortment of Lassa and Mopeia
viruses. J Virol 2005;79(22):13934–42.
198
�V. Raabe, A.K. Mehta, J.D. Evans et al.
International Journal of Infectious Diseases 119 (2022) 187–200
Lukashevich IS, Stelmakh TA, Golubev VP, Stchesljenok EP, Lemeshko NN. Ribonucleic acids of Machupo and Lassa viruses. Arch Virol 1984;79(3-4):189–203.
Madelain V, Duthey A, Mentre F, Jacquot F, Solas C, Lacarelle B, et al. Ribavirin does
not potentiate favipiravir antiviral activity against Ebola virus in non-human
primates. Antiviral Res 2020;177.
Mahanty S, Hutchinson K, Agarwal S, McRae M, Rollin PE, Pulendran B. Cutting
edge: impairment of dendritic cells and adaptive immunity by Ebola and Lassa
viruses. J Immunol 2003;170(6):2797–801.
Manning JT, Forrester N, Paessler S. Lassa virus isolates from Mali and the Ivory
Coast represent an emerging fifth lineage. Front Microbiol 2015;6:1037.
Markosyan RM, Marin M, Zhang Y, Cohen FS, Melikyan GB. The late endosome-resident lipid bis(monoacylglycero)phosphate is a cofactor for Lassa virus fusion.
PLoS Pathog 2021;17(9).
Maruyama J, Mateer EJ, Manning JT, Sattler R, Seregin AV, Bukreyeva N, et al. Adenoviral vector-based vaccine is fully protective against lethal Lassa fever challenge in Hartley guinea pigs. Vaccine 2019;37(45):6824–31.
Marzi A, Feldmann F, Geisbert TW, Feldmann H, Safronetz D. Vesicular stomatitis virus-based vaccines against Lassa and Ebola viruses. Emerg Infect Dis
2015;21(2):305–7.
Mateer EJ, Maruyama J, Card GE, Paessler S, Huang C. Lassa virus, but not highly
pathogenic new world arenaviruses, restricts immunostimulatory double-stranded RNA accumulation during infection. J Virol 2020;94(9):e02006–19.
Mateo M, Reynard S, Carnec X, Journeaux A, Baillet N, Schaeffer J, et al. Vaccines inducing immunity to Lassa virus glycoprotein and nucleoprotein protect
macaques after a single shot. Sci Transl Med 2019;11(512).
Mateo M, Reynard S, Journeaux A, Germain C, Hortion J, Carnec X, et al. A single-shot Lassa vaccine induces long-term immunity and protects cynomolgus
monkeys against heterologous strains. Sci Transl Med 2021;13(597).
McCormick JB. Epidemiology and control of Lassa fever. Curr Top Microbiol Immunol
1987;134:69–78.
McCormick JB, King IJ, Webb PA, Johnson KM, O’Sullivan R, Smith ES, et al. A case–
control study of the clinical diagnosis and course of Lassa fever. J Infect Dis
1987a;155(3):445–55.
McCormick JB, King IJ, Webb PA, Scribner CL, Craven RB, Johnson KM, et al. Lassa
fever. N Engl J Med 1986;314(1):20–6.
McCormick JB, Webb PA, Krebs JW, Johnson KM, Smith ES. A prospective study of
the epidemiology and ecology of Lassa fever. J Infect Dis 1987b;155(3):437–44.
McLay L, Ansari A, Liang Y, Ly H. Targeting virulence mechanisms for the prevention
and therapy of arenaviral hemorrhagic fever. Antiviral Res 2013;97(2):81–92.
Merson L, Bourner J, Jalloh S, Erber A, Salam AP, Flahault A, et al. Clinical characterization of Lassa fever: A systematic review of clinical reports and research to
inform clinical trial design. PLoS Negl Trop Dis 2021;15(9).
Mire CE, Cross RW, Geisbert JB, Borisevich V, Agans KN, Deer DJ, et al. Human-monoclonal-antibody therapy protects nonhuman primates against advanced Lassa
fever. Nat Med 2017;23(10):1146–9.
Monath TP, Maher M, Casals J, Kissling RE, Cacciapuoti A. Lassa fever in the
Eastern Province of Sierra Leone, 1970-1972. II. Clinical observations and
virological studies on selected hospital cases. Am J Trop Med Hyg
1974;23(6):1140–9.
Monson MH, Cole AK, Frame JD, Serwint JR, Alexander S, Jahrling PB. Pediatric Lassa
fever: A review of 33 Liberian cases. Am J Trop Med Hyg 1987;36(2):408–15.
Muller H, Fehling SK, Dorna J, Urbanowicz RA, Oestereich L, Krebs Y, et al. Adjuvant formulated virus-like particles expressing native-like forms of the Lassa
virus envelope surface glycoprotein are immunogenic and induce antibodies
with broadly neutralizing activity. NPJ vaccines 2020;5(1):71.
Nagata T, Lefor AK, Hasegawa M, Ishii M. Favipiravir: A New Medication
for the Ebola Virus Disease Pandemic. Disaster Med Public Health Prep
2015;9(1):79–81.
Nunberg JH, York J. The curious case of arenavirus entry, and its inhibition. Viruses
2012;4(1):83–101.
Oestereich L, Ludtke A, Ruibal P, Pallasch E, Kerber R, Rieger T, et al. Chimeric mice
with competent hematopoietic immunity reproduce key features of severe Lassa
fever. PLoS Pathog 2016a;12(5).
Oestereich L, Rieger T, Ludtke A, Ruibal P, Wurr S, Pallasch E, et al. Efficacy of favipiravir alone and in combination with ribavirin in a lethal, immunocompetent
mouse model of Lassa fever. J Infect Dis 2016b;213(6):934–8.
Okokhere P, Colubri A, Azubike C, Iruolagbe C, Osazuwa O, Tabrizi S, et al. Clinical and laboratory predictors of Lassa fever outcome in a dedicated treatment
facility in Nigeria: a retrospective, observational cohort study. Lancet Infect Dis
2018;18(6):684–95.
Okokhere PO, Erameh CO, Alikah F, Akhideno PE, Iruolagbe CO, Osazuwa OO, et al.
Acute Lassa virus encephalitis with Lassa virus in the cerebrospinal fluid but
absent in the blood: A case report with a positive outcome. Case Rep Neurol
2018;10(2):150–8.
Olayemi A, Cadar D, Magassouba NF, Obadare A, Kourouma F, Oyeyiola A, et al. New
Hosts of The Lassa Virus. Sci Rep 2016;6:25280.
Olayemi A, Oyeyiola A, Obadare A, Igbokwe J, Adesina AS, Onwe F, et al. Widespread
arenavirus occurrence and seroprevalence in small mammals. Nigeria. Parasit
Vectors 2018;11(1):416.
Olschläger S, Günther S. Rapid and specific detection of Lassa virus by reverse transcription-PCR coupled with oligonucleotide array hybridization. J Clin Microbiol
2012;50(7):2496–9.
Olschlager S, Lelke M, Emmerich P, Panning M, Drosten C, Hass M, et al. Improved
detection of Lassa virus by reverse transcription-PCR targeting the 5� region of
S RNA. J Clin Microbiol 2010;48(6):2009–13.
Pannetier D, Reynard S, Russier M, Carnec X, Baize S. Production of CXC and CC
chemokines by human antigen-presenting cells in response to Lassa virus or
closely related immunogenic viruses, and in cynomolgus monkeys with lassa
fever. PLoS neglected tropical diseases 2014;8(1):e2637.
Pannetier D, Reynard S, Russier M, Journeaux A, Tordo N, Deubel V, et al. Human dendritic cells infected with the nonpathogenic Mopeia virus induce
stronger T-cell responses than those infected with Lassa virus. Journal of virology 2011;85(16):8293–306.
Port JR, Wozniak DM, Oestereich L, Pallasch E, Becker-Ziaja B, Muller J, et al. Severe
human Lassa gever is characterized by nonspecific T-cell activation and lymphocyte homing to inflamed tissues. J Virol 2020;94(21).
Price ME, Fisher-Hoch SP, Craven RB, McCormick JB. A prospective study of maternal and fetal outcome in acute Lassa fever infection during pregnancy. BMJ
1988;297(6648):584–7.
Qi X, Lan S, Wang W, Schelde LM, Dong H, Wallat GD, et al. Cap binding and immune evasion revealed by Lassa nucleoprotein structure. Nature
2010;468(7325):779–83.
Raabe V, Koehler J. Laboratory diagnosis of Lassa fever. J Clin Microbiol
2017;55(6):1629–37.
Raabe VN, Kann G, Ribner BS, Morales A, Varkey JB, Mehta AK, et al. Favipiravir and
ribavirin treatment of epidemiologically linked cases of Lassa fever. Clin Infect
Dis 2017;65(5):855–9.
Redding DW, Gibb R, Dan-Nwafor CC, Ilori EA, Yashe RU, Oladele SH, et al. Geographical drivers and climate-linked dynamics of Lassa fever in Nigeria. Nat
Commun 2021;12(1):5759.
Richmond JK, Baglole DJ. Lassa fever: Epidemiology, clinical features, and social consequences. BMJ 2003;327(7426):1271–5.
Rodrigo WW, Ortiz-Riano E, Pythoud C, Kunz S, de la Torre JC, Martinez-Sobrido L.
Arenavirus nucleoproteins prevent activation of nuclear factor kappa B. J Virol
2012;86(15):8185–97.
Rosenke K, Feldmann H, Westover JB, Hanley PW, Martellaro C, Feldmann F, et al.
Use of Favipiravir to Treat Lassa Virus Infection in Macaques. Emerg Infect Dis
2018;24(9):1696–9.
Russier M, Reynard S, Carnec X, Baize S. The exonuclease domain of Lassa virus nucleoprotein is involved in antigen-presenting-cell-mediated NK cell responses.
Journal of virology 2014;88(23):13811–20.
Safronetz D, Mire C, Rosenke K, Feldmann F, Haddock E, Geisbert T, et al. A recombinant vesicular stomatitis virus-based Lassa fever vaccine protects guinea
pigs and macaques against challenge with geographically and genetically distinct Lassa viruses. PLoS Negl Trop Dis 2015;9(4) -e.
Safronetz D, Rosenke K, Westover JB, Martellaro C, Okumura A, Furuta Y, et al. The
broad-spectrum antiviral favipiravir protects guinea pigs from lethal Lassa virus
infection post-disease onset. Sci Rep 2015;5:14775.
Salam AP, Cheng V, Edwards T, Olliaro P, Sterne J, Horby P. Time to reconsider the
role of ribavirin in Lassa fever. PLoS Negl Trop Dis 2021;15(7).
Salvato MS, Domi A, Guzmán-Cardozo C, Medina-Moreno S, Zapata JC, Hsu H, et al.
A Single Dose of Modified Vaccinia Ankara Expressing Lassa Virus-like Particles Protects Mice from Lethal Intra-cerebral Virus Challenge. Pathogens (Basel,
Switzerland) 2019;8(3):133.
Samuels RJ, Moon TD, Starnes JR, Alhasan F, Gbakie M, Goba A, et al. Lassa fever
among children in Eastern province, Sierra Leone: A 7-year retrospective analysis (2012-2018). Am J Trop Med Hyg 2020;104(2):585–92.
Schaeffer J, Carnec X, Reynard S, Mateo M, Picard C, Pietrosemoli N, et al. Lassa
virus activates myeloid dendritic cells but suppresses their ability to stimulate
T cells. PLoS pathogens 2018;14(11).
Shaibu JO, Salu OB, Amoo OS, Idigbe I, Musa AZ, Ezechi OC, et al. Immunological
screening of Lassa Virus among health workers and contacts of patients of Lassa
fever in Ondo State. Immunobiology 2021;226(3).
Shankar S, Whitby LR, HE Casquilho-Gray, York J, Boger DL, Nunberg JH.
Small-molecule fusion inhibitors bind the pH-sensing stable signal peptide-GP2 subunit interface of the Lassa virus envelope glycoprotein. J Virol
2016;90(15):6799–807.
Shehu NY, Gomerep SS, Isa SE, Iraoyah KO, Mafuka J, Bitrus N, et al. Lassa fever
2016 outbreak in Plateau State, Nigeria-The changing epidemiology and clinical
presentation. Front Public Health 2018;6:232.
Shieh WJ, Demby A, Jones T, Goldsmith CS, Rollin PE, Ksiazek TG, et al. Pathology
and pathogenesis of Lassa fever: Novel immunohistochemical findings in fatal
cases and clinico-pathologic correlation. Clin Infect Dis 2021.
Shimojima M, Stroher U, Ebihara H, Feldmann H, Kawaoka Y. Identification of cell
surface molecules involved in dystroglycan-independent Lassa virus cell entry. J
Virol 2012;86(4):2067–78.
Spiropoulou CF, Kunz S, Rollin PE, Campbell KP, Oldstone MBA. New World arenavirus clade C, but not clade A and B viruses, utilizes alpha-dystroglycan as its
major receptor. J Virol 2002;76(10):5140–6.
Stein DR, Warner BM, Audet J, Soule G, Siragam V, Sroga P, et al. Differential pathogenesis of closely related 2018 Nigerian outbreak clade III Lassa virus isolates.
PLoS Pathog 2021;17(10).
Takenaga T, Zhang Z, Muramoto Y, Fehling SK, Hirabayashi A, Takamatsu Y, et al.
CP100356 hydrochloride, a P-glycoprotein inhibitor, inhibits Lassa virus entry: implication of a candidate pan-mammarenavirus entry inhibitor. Viruses
2021;13(9).
Tomori O, Fabiyi A, Sorungbe A, Smith A, McCormick JB. Viral hemorrhagic
fever antibodies in Nigerian populations. Am J Trop Med Hyg 1988;38(2):
407–410.
Urata S, Noda T, Kawaoka Y, Yokosawa H, Yasuda J. Cellular factors required for
Lassa virus budding. J Virol 2006;80(8):4191–5.
199
�V. Raabe, A.K. Mehta, J.D. Evans et al.
International Journal of Infectious Diseases 119 (2022) 187–200
Usifoh SF, Odigie AE, Ighedosa SU, Uwagie-Ero EA, Aighewi IT. Lassa Fever-associated Stigmatization among Staff and Students of the University of Benin, Nigeria. J Epidemiol Glob Health 2019;9(2):107–15.
Walker DH, McCormick JB, Johnson KM, Webb PA, Komba-Kono G, Elliott LH,
et al. Pathologic and virologic study of fatal Lassa fever in man. Am J Pathol
1982;107(3):349–56.
Walker DH, Wulff H, Lange JV, Murphy FA. Comparative pathology of Lassa virus
infection in monkeys, guinea-pigs, and Mastomys natalensis. Bull World Health
Organ 1975;52(4-6):523–34.
Wang J, Zhao S, Chen X, Huang Z, Chong MKC, Guo Z, et al. The reproductive number of Lassa fever: A systematic review. J Travel Med 2021;28(3).
Wang M, Jokinen J, Tretyakova I, Pushko P, Lukashevich IS. Alphavirus vector-based
replicon particles expressing multivalent cross-protective Lassa virus glycoproteins. Vaccine 2018;36(5):683–90.
Wang M, Li R, Li Y, Yu C, Chi X, Wu S, et al. Construction and immunological evaluation of an adenoviral vector-based vaccine candidate for Lassa fever. Viruses
2021;13(3).
Wang P, Liu Y, Zhang G, Wang S, Guo J, Cao J, et al. Screening and identification of Lassa virus entry inhibitors from an FDA-approved drug library. J Virol
2018;92(16).
Wauquier N, Couffignal C, Manchon P, Smith E, Lungay V, Coomber M, et al. High
heart rate at admission as a predictive factor of mortality in hospitalized patients with Lassa fever: An observational cohort study in Sierra Leone. J Infect
2020;80(6):671–93.
Whitmer SLM, Strecker T, Cadar D, Dienes HP, Faber K, Patel K, et al. New lineage
of Lassa virus, Togo, 2016. Emerg Infect Dis 2018;24(3):599–602.
Winn Jr WC, Walker DH. The pathology of human Lassa fever. Bull World Health
Organ 1975;52(4-6):535–45.
Wolf T, Ellwanger R, Goetsch U, Wetzstein N, Gottschalk R. Fifty years of imported
Lassa fever: a systematic review of primary and secondary cases. J Travel Med
2020;27(4).
Wood R, Bangura U, Mariën J, Douno M, Fichet-Calvet E. Detection of Lassa virus in
wild rodent feces: Implications for Lassa fever burden within households in the
endemic region of Faranah. Guinea. One Health 2021;13.
World Health Organization. 2017 Annual review of diseases prioritized under the
research and development blueprint. Geneva, Switzerland: World Health Organization; 2017a.
World Health Organization. Lassa fever; 2017b Available from: https://www.who.
int/news-room/fact-sheets/detail/lassa-fever [Accessed 10 June 2021].
World Health Organization. Lassa fever – United Kingdom of Great Britain and
Northern Ireland. Disease Outbreak News 2022.
Xing J, Ly H, Liang Y. The Z proteins of pathogenic but not nonpathogenic arenaviruses inhibit RIG-I-like receptor-dependent interferon production. J Virol
2015;89(5):2944–55.
Xu X, Peng R, Peng Q, Wang M, Xu Y, Liu S, et al. Cryo-EM structures of Lassa
and Machupo virus polymerases complexed with cognate regulatory Z proteins
identify targets for antivirals. Nat Microbiol 2021;6(7):921–31.
Yadouleton A, Agolinou A, Kourouma F, Saizonou R, Pahlmann M, Bedié SK,
et al. Lassa Virus in Pygmy Mice, Benin, 2016-2017. Emerg Infect Dis
2019;25(10):1977–9.
Yao W, Yang Z, Lou X, Mao H, Yan H, Zhang Y. Simultaneous detection of Ebola
virus and pathogens associated with hemorrhagic fever by an oligonucleotide
microarray. Front Microbiol 2021;12.
Yun NE, Poussard AL, Seregin AV, Walker AG, Smith JK, Aronson JF, et al.
Functional interferon system is required for clearance of lassa virus. J Virol
2012;86(6):3389–92.
Yun NE, Ronca S, Tamura A, Koma T, Seregin AV, Dineley KT, et al. Animal model
of sensorineural hearing loss associated with Lassa virus infection. J Virol
2015;90(6):2920–7.
Zapata JC, Poonia B, Bryant J, Davis H, Ateh E, George L, et al. An attenuated Lassa
vaccine in SIV-infected rhesus macaques does not persist or cause arenavirus
disease but does elicit Lassa virus-specific immunity. Virol J 2013;10:52.
Zhang G, Cao J, Cai Y, Liu Y, Li Y, Wang P, et al. Structure-activity relationship optimization for lassa virus fusion inhibitors targeting the transmembrane domain
of GP2. Protein Cell 2019;10(2):137–42.
Zhang X, Tang K, Guo Y. The antifungal isavuconazole inhibits the entry of lassa
virus by targeting the stable signal peptide-GP2 subunit interface of lassa virus
glycoprotein. Antiviral Res 2020;174.
200
�
Dublin Core
The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.
Title
A name given to the resource
Discover
Description
An account of the resource
<div style="background-color:#c7e5f8;">
<h2 style="background-color:#c7e5f8;"><span style="font-size:80%;line-height:24px;"><a href="https://repository.netecweb.org/exhibits/show/ncov/ncov"><button>COVID-19 Update</button></a><a href="https://repository.netecweb.org/news#Map"><button>Outbreak Map</button></a><a href="https://repository.netecweb.org/news#News"><button>Newsfeed</button></a><a href="https://repository.netecweb.org/exhibits/show/monkeypox/monkeypox"><button>Monkeypox 2021</button></a><a href="https://repository.netecweb.org/exhibits/show/drcebola2018/drcebola2018"><button>2020 Ebola Update</button></a><a href="https://repository.netecweb.org/ebolatimeline"><button>Ebola Timeline</button></a><a href="https://repository.netecweb.org/exhibits/show/mers/mers"><button>MERS</button></a><a href="https://repository.netecweb.org/exhibits/show/aerosol/aerosol"><button>Airborne Transmission</button></a></span></h2>
<h2 style="background-color:#c7e5f8;">Discover Background Data and Resources:</h2>
<ul><li>
<p><span style="line-height:24px;">Get introduced to NETEC through the interactive timeline of special pathogens below.* This timeline describes some significant special pathogen events in recent history.</span></p>
</li>
<li>
<p><span style="line-height:24px;">Find out more about the 2014 Ebola outbreak and the development of the ASPR/CDC-supported network of healthcare facilities preparing for the next outbreak through <em><a href="/ebolatimeline"><button>the Ebola timeline</button></a>.</em></span></p>
</li>
</ul><ul><li>
<p><span style="line-height:24px;">This NETEC Repository helps to provide training and educational resources to prepare for future special pathogen events. </span></p>
</li>
</ul><ul><li>
<p><span style="line-height:24px;">Explore the files BELOW THE TIMELINE to <em><strong>discover and learn</strong></em> more about Ebola and other Special Pathogens, an overview of special pathogens, clinically managing patients affected, and readying healthcare teams and systems to keep everyone safe.</span></p>
</li>
</ul><h2 style="background-color:#c7e5f8;">Timeline of Special Pathogens:</h2>
<a href="#click">Skip timeline</a>
<p style="margin-bottom:0;"><iframe width="100%" height="635" style="border:1px solid #000000;" src="https://cdn.knightlab.com/libs/timeline3/latest/embed/index.html?source=1AQiHJEzkhEi71uIi7wTWWgSFRwR6wRbRyfhbASrw3Ig&font=Default&lang=en&initial_zoom=2&height=650" title="Timeline of Special Pathogens"></iframe></p>
<h2 style="background-color:#c7e5f8;"><span style="font-size:70%;">*Click for <a href="/timeline2access"><button>a screen reader accessible table of this timeline</button></a>. </span></h2>
</div>
Publication
A peer reviewed publication.
Citation
Citation information for the publication itself.
Raabe, V., A. K. Mehta, and J. D. Evans. 2022. "Lassa Virus Infection: a Summary for Clinicians." Int J Infect Dis 119:187-200. doi: 10.1016/j.ijid.2022.04.004.
Abstract
<p><strong>Objectives</strong></p>
<p class="section-paragraph">This summary on Lassa virus (LASV) infection and Lassa fever disease (LF) was developed from a clinical perspective to provide clinicians with a condensed, accessible understanding of the current literature. The information provided highlights pathogenesis, clinical features, and diagnostics emphasizing therapies and vaccines that have demonstrated potential value for use in clinical or research environments.</p>
<p><strong>Methods</strong></p>
<p class="section-paragraph">We conducted an integrative literature review on the clinical and pathological features, vaccines, and treatments for LASV infection, focusing on recent studies and <em>in vivo</em> evidence from humans and/or non-human primates (NHPs), when available.</p>
<p><strong>Results</strong></p>
<p class="section-paragraph">Two antiviral medications with potential benefit for the treatment of LASV infection and 1 for post-exposure prophylaxis were identified, although a larger number of therapeutic candidates are currently being evaluated. Multiple vaccine platforms are in pre-clinical development for LASV prevention, but data from human clinical trials are not yet available.</p>
<p><strong>Conclusion</strong></p>
<p class="section-paragraph">We provide succinct summaries of medical countermeasures against LASV to give the busy clinician a rapid reference. Although there are no approved drugs or vaccines for LF, we provide condensed information from a literature review for measures that can be taken when faced with a suspected infection, including investigational treatment options and hospital engineering controls.</p>
<p><strong>Keywords</strong></p>
<ul>
<li>Lassa virus</li>
<li>Lassa fever</li>
<li>antiviral therapy</li>
<li>antiviral countermeasure</li>
<li>vaccine</li>
<li>viral hemorrhagic fever</li>
</ul>
Accessibility
Information on accessibility of the document(s), such as university log-in necessary, request form, open access, etc.
Open Access on journal site. This is an open access article under the CC-BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/ ).
URL
https://pubmed.ncbi.nlm.nih.gov/35395384/
Read Online
Online location of the resource.
https://www.ijidonline.com/article/S1201-9712(22)00205-3/fulltext
Dublin Core
The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.
Title
A name given to the resource
Lassa Virus Infection: a Summary for Clinicians
Subject
The topic of the resource
General
Description
An account of the resource
This summary on Lassa virus (LASV) infection and Lassa fever disease (LF) was developed from a clinical perspective to provide clinicians with a condensed, accessible understanding of the current literature. The information provided highlights pathogenesis, clinical features, and diagnostics emphasizing therapies and vaccines that have demonstrated potential value for use in clinical or research environments.
Creator
An entity primarily responsible for making the resource
Science Working Group of the National Emerging Special Pathogens Training and Education Center (NETEC) Special Pathogens Research Network (SPRN)
Source
A related resource from which the described resource is derived
Vanessa Raabe, Aneesh K Mehta, Jared D Evans
Date
A point or period of time associated with an event in the lifecycle of the resource
2022-04-05
Type
The nature or genre of the resource
Publication
Coverage
The spatial or temporal topic of the resource, the spatial applicability of the resource, or the jurisdiction under which the resource is relevant
2023-07-25
Clinical Care
Lassa
R-Res&Pub
-
https://repository.netecweb.org/files/original/3dba1f634c3a18e0ee58edcfe5c8772e.png
4cf17b29ba7b6db239dc5fe3cd70aa33
Dublin Core
The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.
Title
A name given to the resource
Discover
Description
An account of the resource
<div style="background-color:#c7e5f8;">
<h2 style="background-color:#c7e5f8;"><span style="font-size:80%;line-height:24px;"><a href="https://repository.netecweb.org/exhibits/show/ncov/ncov"><button>COVID-19 Update</button></a><a href="https://repository.netecweb.org/news#Map"><button>Outbreak Map</button></a><a href="https://repository.netecweb.org/news#News"><button>Newsfeed</button></a><a href="https://repository.netecweb.org/exhibits/show/monkeypox/monkeypox"><button>Monkeypox 2021</button></a><a href="https://repository.netecweb.org/exhibits/show/drcebola2018/drcebola2018"><button>2020 Ebola Update</button></a><a href="https://repository.netecweb.org/ebolatimeline"><button>Ebola Timeline</button></a><a href="https://repository.netecweb.org/exhibits/show/mers/mers"><button>MERS</button></a><a href="https://repository.netecweb.org/exhibits/show/aerosol/aerosol"><button>Airborne Transmission</button></a></span></h2>
<h2 style="background-color:#c7e5f8;">Discover Background Data and Resources:</h2>
<ul><li>
<p><span style="line-height:24px;">Get introduced to NETEC through the interactive timeline of special pathogens below.* This timeline describes some significant special pathogen events in recent history.</span></p>
</li>
<li>
<p><span style="line-height:24px;">Find out more about the 2014 Ebola outbreak and the development of the ASPR/CDC-supported network of healthcare facilities preparing for the next outbreak through <em><a href="/ebolatimeline"><button>the Ebola timeline</button></a>.</em></span></p>
</li>
</ul><ul><li>
<p><span style="line-height:24px;">This NETEC Repository helps to provide training and educational resources to prepare for future special pathogen events. </span></p>
</li>
</ul><ul><li>
<p><span style="line-height:24px;">Explore the files BELOW THE TIMELINE to <em><strong>discover and learn</strong></em> more about Ebola and other Special Pathogens, an overview of special pathogens, clinically managing patients affected, and readying healthcare teams and systems to keep everyone safe.</span></p>
</li>
</ul><h2 style="background-color:#c7e5f8;">Timeline of Special Pathogens:</h2>
<a href="#click">Skip timeline</a>
<p style="margin-bottom:0;"><iframe width="100%" height="635" style="border:1px solid #000000;" src="https://cdn.knightlab.com/libs/timeline3/latest/embed/index.html?source=1AQiHJEzkhEi71uIi7wTWWgSFRwR6wRbRyfhbASrw3Ig&font=Default&lang=en&initial_zoom=2&height=650" title="Timeline of Special Pathogens"></iframe></p>
<h2 style="background-color:#c7e5f8;"><span style="font-size:70%;">*Click for <a href="/timeline2access"><button>a screen reader accessible table of this timeline</button></a>. </span></h2>
</div>
Publication
A peer reviewed publication.
Citation
Citation information for the publication itself.
Strampe, Jamie, Danny A. Asogun, Emily Speranza, Meike Pahlmann, Ali Soucy, Sabrina Bockholt, Elisa Pallasch, Beate Becker-Ziaja, Sophie Duraffour, Nahid Bhadelia, Yemisi Ighodalo, Jennifer Oyakhilome, Emmanuel O. Omomoh, Thomas Olokor, Donatus I. Adomeh, Odia Ikponwonsa, Chris Aire, Ekaete Tobin, Nosa Akpede, Peter O. Okokhere, Sylvanus A. Okogbenin, George O. Akpede, César Muñoz-Fontela, Ephraim Ogbaini-Emovon, Stephan Günther, John H. Connor, and Lisa Oestereich. 2021. "Factors associated with progression to death in patients with Lassa fever in Nigeria: an observational study." The Lancet Infectious Diseases.
Abstract
<h3>Background</h3>
<div class="section-paragraph">Lassa fever is endemic in several west African countries. Case-fatality rates ranging from 21% to 69% have been reported. The pathophysiology of the disease in humans and determinants of mortality remain poorly understood. We aimed to determine host protein biomarkers capable of determining disease outcome.</div>
<h3>Methods</h3>
<div class="section-paragraph">In this observational study, we analysed left-over blood samples from patients who tested positive for Lassa fever at Irrua Specialist Teaching Hospital, Nigeria, between January, 2014, and April, 2017. We measured viral load, concentrations of clinical chemistry parameters, and levels of 62 circulating proteins involved in inflammation, immune response, and haemostasis. Patients with a known outcome (survival or death) and at least 200 μL of good-quality diagnostic sample were included in logistic regression modelling to assess the correlation of parameters with Lassa fever outcome. Individuals who gave consent could further be enrolled into a longitudinal analysis to assess the association of parameters with Lassa fever outcome over time. Participants were divided into two datasets for the statistical analysis: a primary dataset (samples taken between Jan 1, 2014, and April 1, 2016), and a secondary dataset (samples taken between April 1, 2016, and April 1, 2017). Biomarkers were ranked by area under the receiver operating characteristic curve (AUC) from highest (most predictive) to lowest (least predictive).</div>
<h3>Findings</h3>
<div class="section-paragraph">Of 554 patients who tested positive for Lassa fever during the study period, 201 (131 in the primary dataset and 70 in the secondary dataset) were included in the biomarker analysis, of whom 74 (49 in the primary dataset and 25 in the secondary dataset) had died and 127 (82 in the primary dataset and 45 in the secondary dataset) had survived. Cycle threshold values (indicating viral load) and levels of 18 host proteins at the time of admission to hospital were significantly correlated with fatal outcome. The best predictors of outcome in both datasets were plasminogen activator inhibitor-1 (PAI-1; AUC 0·878 in the primary dataset and 0·876 in the secondary dataset), soluble thrombomodulin (TM; 0·839 in the primary dataset and 0·875 in the secondary dataset), and soluble tumour necrosis factor receptor superfamily member 1A (TNF-R1; 0·807 in the primary dataset and 0·851 in the secondary dataset), all of which had higher prediction accuracy than viral load (0·774 in the primary dataset and 0·837 in the secondary dataset). Longitudinal analysis (150 patients, of whom 36 died) showed that of the biomarkers that were predictive at admission, PAI-1 levels consistently decreased to normal levels in survivors but not in those who died.</div>
<h3>Interpretation</h3>
<div class="section-paragraph">The identification of PAI-1 and soluble TM as markers of fatal Lassa fever at admission, and of PAI-1 as a marker of fatal Lassa fever over time, suggests that dysregulated coagulation and fibrinolysis and endothelial damage have roles in the pathophysiology of Lassa fever, providing a mechanistic explanation for the association of Lassa fever with oedema and bleeding. These novel markers might aid in clinical risk stratification and disease monitoring.</div>
<h3>Funding</h3>
<div class="section-paragraph">German Research Foundation, Leibniz Association, and US National Institutes of Health.</div>
Accessibility
Information on accessibility of the document(s), such as university log-in necessary, request form, open access, etc.
Online through the Lancet.
URL
https://www.thelancet.com/journals/laninf/article/PIIS1473-3099(20)30737-4/fulltext
Read Online
Online location of the resource.
https://www.thelancet.com/journals/laninf/article/PIIS1473-3099(20)30737-4/fulltext
Dublin Core
The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.
Title
A name given to the resource
Factors associated with progression to death in patients with Lassa fever in Nigeria: an observational study
Subject
The topic of the resource
Research
Description
An account of the resource
Lassa fever is endemic in several west African countries. Case-fatality rates ranging from 21% to 69% have been reported. The pathophysiology of the disease in humans and determinants of mortality remain poorly understood. We aimed to determine host protein biomarkers capable of determining disease outcome.
Creator
An entity primarily responsible for making the resource
Strampe, Jamie, Danny A. Asogun, Emily Speranza, Meike Pahlmann, Ali Soucy, Sabrina Bockholt, Elisa Pallasch, Beate Becker-Ziaja, Sophie Duraffour, Nahid Bhadelia, Yemisi Ighodalo, Jennifer Oyakhilome, Emmanuel O. Omomoh, Thomas Olokor, Donatus I. Adomeh, Odia Ikponwonsa, Chris Aire, Ekaete Tobin, Nosa Akpede, Peter O. Okokhere, Sylvanus A. Okogbenin, George O. Akpede, César Muñoz-Fontela, Ephraim Ogbaini-Emovon, Stephan Günther, John H. Connor, and Lisa Oestereich.
Date
A point or period of time associated with an event in the lifecycle of the resource
2021-01-20
Type
The nature or genre of the resource
Publication
Lassa
Outcomes
R-Res&Pub
Treatment and Care
Viral Hemorrhagic Fever
-
https://repository.netecweb.org/files/original/0960b8c92eab586586d62e37f88524ab.pdf
b783a0b902526ba5f1604c4ba4531dc1
PDF Text
Text
Viral Hemorrhagic Fever (VHF) or Orthopox Virus~ ED Screening
LOCATION
ROLE
ED Front
Desk Area
Greeter/
Triage RN
1
PROCESS STEPS
NOTES
Patient History Gathered
Ask: Exposure and Symptom questions:
VHF (Ebola, Lassa, Marburg,
etc.) or Orthopox (Smallpox or
Monkeypox) Outbreak Areas:
Hotpots updated in EPIC check
in process
If YES to cough, fever, or rash provide patient mask
Greeter/
Triage RN
2
Ask: Travel Question - Have you traveled
outside of the country within the last month?
NO
YES
3
Greeter/
Triage RN
Screening
Complete
Ask: To what country? Enter countries and
date of return.
System evaluates responses, alerts fire if criteria
is met for symptomatic travel to a hot spot.
Alert Appears:
Follow prompts Greeter Nurse don
PPE
NO
Alert
s
Screening
Complete
Compatible VHF SymptomsCheck www.cdc.gov Case
Definition: fever (>100.4F/38C),
history of fever, headache,
weakness, muscle pain, vomiting,
diarrhea, abdominal pain or
hemorrhage
If positive travel history but no
symptoms: Patient to self-monitor
symptoms for 21 days. Call PCP
or 911 if symptoms develop.
Instructions will automatically
print on the AVS.
Staff to avoid close contact if
asymptomatic travel to hot spot
If patient arrives with family member(s). If not skip to step 6.
Greeter/
Triage RN
4
Family History Gathered
Does family member have ANY of
the symptoms listed above?
YES
Greeter/
Triage RN
5
Greeter/
Triage RN
6
Ask ED front desk staff to call Lead RN to (1)
report positive history/symptoms and (2) check
on availability of designated rooms
YES
7
Take family to E7 or E8
Provide family members procedure
mask and instruct on how to apply.
Hand hygiene available.
Designated Room Available?
Lead RN
Greeter/
Triage RN
NO
NO
If any family member is
symptomatic, designate
a 2nd “Patient Room” for
that family member-E7
or 8. *move current
occupants to hallway if
needed.
Designated Room:
NMC: E6-E7(- pressure)
& E8 (storage)
BMC: #12
Clear and
Disinfect Rooms
Place camera and
speakers in Room
Escort patient(s) to Room.
Instruct patient to (1) remain in room, (2) keep
door closed, and (3) an RN will be with them
as soon as he/she has proper PPE
Page 1 of 3
3/2022
�Viral Hemorrhagic Fever or Orthopox~ ED Screening
LOCATION
ROLE
Lead RN
Lead RN
Lead RN
PROCESS STEPS
8
9
10
Establish who will serve in each of the
following roles: (1) Primary RN, (2)
Doffer RN and (3) Task RN/Tech
(1) Tape “Do Not Enter” sign to Pt. Room
(2) Tape “Room Entry Log” to Pt. Room
(3) Tape “Soiled Utility” sign to Approp. Room
(4) Tape “Do Not Use” sign to Nurse Server
11
Primary RN
Don Biocontainment Level PPE
Print VHF or Orthopoxes Workflow
from Intranet Page:
Under Infectious Disease Protocols
Pick up “VHF or Orthopoxes” Starter
Kit”
Donning RN
Don NBU Level PPE
Lead RN
Observe Donning process
Primary RN
Physician
Station w/
Video Link
Installed
Staff MD
Triage
Room
Staff MD
See ED 24hr Sheet for On Call
Manager and Director Contact Info
Notify ED Manager On Call of
possible VHF or Orthopox Patient
Notify Infection Control (ICE) 402.888.4646 of
possible VHF or Orthopox Patient
ED Mgr.
On Call
Isolation
Room
NOTES
Biocontainment Level PPE:
N95, face shield, fluid impermeable
hood, AAMI level 4 gown, boot
covers, 3 pairs of gloves, apron as
needed
12
Gather full set of vitals and any
additional pertinent information
All People Entering Room must
sign in on “Room Entry Log”
before each entry into the
isolation room
13
Patient (1) symptomatic and (2)
meets CDC Case Definition?
Using Video Link
YES
14
Don VHF PPE
If symptomatic and meets NO CDC Case
Definition: STOP and Provide Routine Cares
and Look for alternative diagnosis
Page 2 of 3
3/2022
�Viral Hemorrhagic Fever or Orthopox~ ED Screening
LOCATION
Isolation
Room
ROLE
PROCESS STEPS
Staff MD
Staff MD
15
16
NOTES
Examine / Assess Patient
No Labs Drawn Yet
No IV’s Started Yet
Call Infection Control (ICE)
XXX.XXX.XXXX who will notify Infection
Control Medical Director on-call
Infection Control Medical Director
and Public Health must approve
lab draw
ICE Medical Director will notify:
ICE Medical
Director
VHF or Orthopox Suspected?
17
NO
YES
Arrange for lab testing
ICE
Isolation
Room
18
Primary RN
19
Consider soft barriers/rolling partitions
for privacy and zone management.
Draw blood and send to NPHL
EUA PCR Test Positive?
YES
20a
(1) County Health Department:
XXX.XXX.XXXX
After 4:30pm: XXX.XXX.XXXX
(3) Public Health Lab (Pager):
XXX.XXX.XXXX
(4) Biocontainment Leadership:
XXX.XXX.XXXX
Pt. Admitted to NBU
NO
20b
Pt. Remains in ED Isolation
Additional labs may be drawn at
this time per MD order and VHF
or Orthopox Lab Draw Protocol
If PUI refuses care: Infection
Control Medical Director to call
State/County Public Health
Director to obtain Isolation Order.
If symptomatic >72hrs, a single EUA PCR is
sufficient to R/O VHF
If <72hrs, Pt. will remain in isolation until 72hrs
has passed and 2nd negative EUA PCR
ED Manager
On Call
21
Notify Public Information Officer (PIO)
and Incident Commander On-Call
Page 3 of 3
3/2022
�
Dublin Core
The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.
Title
A name given to the resource
Develop
Description
An account of the resource
<h2><span>These files will help you <strong><em>develop</em></strong> your program and plans based on what you have discovered.</span></h2>
<p style="font-size:120%;">Find model protocols and procedures and more in-depth training resources. You can go to the <a href="/exhibits/show/leadership"><button>Leadership Toolbox</button></a> or the <a href="https://repository.netecweb.org/exhibits/show/specialpopulations"><button>Special Populations</button></a> section. You can also go to the <a href="https://repository.netecweb.org/exhibits/show/netec-education/justintime"><button> Just in Time Training</button></a> page, the <a href="https://repository.netecweb.org/exhibits/show/ppe101/ppe"><button> PPE</button></a> page, or the <a href="https://repository.netecweb.org/exhibits/show/ems/prehospital"><button>EMS</button></a> page. <span>Subscribe to the NETEC <a href="https://www.youtube.com/channel/UCDpHc1LkcEpiWR0q7ll5eZQ" target="_blank" rel="noreferrer noopener"><button>Youtube Channel</button></a> to get all new Skills videos!</span></p>
Guide
Document providing operation or response information, general guidance documents.
Dublin Core
The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.
Title
A name given to the resource
Viral Hemorrhagic Fever (VHF) or Orthopox Virus ~ ED Screening
Subject
The topic of the resource
Infection Control
Description
An account of the resource
Viral Hemorrhagic Fever or Orthopox Virus Emergency Department Screening
Creator
An entity primarily responsible for making the resource
University of Nebraska Medical Center / Nebraska Medicine
Date
A point or period of time associated with an event in the lifecycle of the resource
2022-03-15
Contributor
An entity responsible for making contributions to the resource
2022-03-17 by Shelly Schwedhelm (to be added)
Coverage
The spatial or temporal topic of the resource, the spatial applicability of the resource, or the jurisdiction under which the resource is relevant
2023-09-24
Ebola
Emergency Department
Lassa
Marburg
Mpox
Orthopox Virus
Outbreaks
R-IIT
Screening Tool
Smallpox
Viral Hemorrhagic Fever
-
https://repository.netecweb.org/files/original/36cb1069338e3e5e1b31e934e7151eaa.png
4808bed06f0d1f1052804436f1915d18
Dublin Core
The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.
Title
A name given to the resource
Discover
Description
An account of the resource
<div style="background-color:#c7e5f8;">
<h2 style="background-color:#c7e5f8;"><span style="font-size:80%;line-height:24px;"><a href="https://repository.netecweb.org/exhibits/show/ncov/ncov"><button>COVID-19 Update</button></a><a href="https://repository.netecweb.org/news#Map"><button>Outbreak Map</button></a><a href="https://repository.netecweb.org/news#News"><button>Newsfeed</button></a><a href="https://repository.netecweb.org/exhibits/show/monkeypox/monkeypox"><button>Monkeypox 2021</button></a><a href="https://repository.netecweb.org/exhibits/show/drcebola2018/drcebola2018"><button>2020 Ebola Update</button></a><a href="https://repository.netecweb.org/ebolatimeline"><button>Ebola Timeline</button></a><a href="https://repository.netecweb.org/exhibits/show/mers/mers"><button>MERS</button></a><a href="https://repository.netecweb.org/exhibits/show/aerosol/aerosol"><button>Airborne Transmission</button></a></span></h2>
<h2 style="background-color:#c7e5f8;">Discover Background Data and Resources:</h2>
<ul><li>
<p><span style="line-height:24px;">Get introduced to NETEC through the interactive timeline of special pathogens below.* This timeline describes some significant special pathogen events in recent history.</span></p>
</li>
<li>
<p><span style="line-height:24px;">Find out more about the 2014 Ebola outbreak and the development of the ASPR/CDC-supported network of healthcare facilities preparing for the next outbreak through <em><a href="/ebolatimeline"><button>the Ebola timeline</button></a>.</em></span></p>
</li>
</ul><ul><li>
<p><span style="line-height:24px;">This NETEC Repository helps to provide training and educational resources to prepare for future special pathogen events. </span></p>
</li>
</ul><ul><li>
<p><span style="line-height:24px;">Explore the files BELOW THE TIMELINE to <em><strong>discover and learn</strong></em> more about Ebola and other Special Pathogens, an overview of special pathogens, clinically managing patients affected, and readying healthcare teams and systems to keep everyone safe.</span></p>
</li>
</ul><h2 style="background-color:#c7e5f8;">Timeline of Special Pathogens:</h2>
<a href="#click">Skip timeline</a>
<p style="margin-bottom:0;"><iframe width="100%" height="635" style="border:1px solid #000000;" src="https://cdn.knightlab.com/libs/timeline3/latest/embed/index.html?source=1AQiHJEzkhEi71uIi7wTWWgSFRwR6wRbRyfhbASrw3Ig&font=Default&lang=en&initial_zoom=2&height=650" title="Timeline of Special Pathogens"></iframe></p>
<h2 style="background-color:#c7e5f8;"><span style="font-size:70%;">*Click for <a href="/timeline2access"><button>a screen reader accessible table of this timeline</button></a>. </span></h2>
</div>
Online Course
Access portal to an online course.
URL
https://openwho.org/courses/lassa-fever-introduction
Duration
Length of time involved (seconds, minutes, hours, days, class periods, etc.)
Approximately 1 hour.
Access
Description of access information (e.g. itunes).
Free with free OpenWHO account.
Dublin Core
The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.
Title
A name given to the resource
Lassa fever: Introduction
Creator
An entity primarily responsible for making the resource
WHO
Subject
The topic of the resource
Training and Exercises
Description
An account of the resource
Lassa fever, a viral haemorrhagic fever with symptoms similar to those of Ebola virus disease, is endemic in much of West Africa and usually sparks a seasonal outbreak from December to March. Humans usually become infected with Lassa virus from exposure to urine and faeces of infected Mastomys rats. Lassa virus may also be spread between humans through direct contact with the blood, urine, faeces, or other bodily secretions of a person infected with Lassa fever. This course provides a general introduction to Lassa fever and is intended for personnel responding to outbreaks in complex emergencies or in settings where the basic environmental infrastructures have been damaged or destroyed. (WHO)
Date
A point or period of time associated with an event in the lifecycle of the resource
2018-07-05
Contributor
An entity responsible for making contributions to the resource
2023-10-17 by Darrell Ruby, T & E group
Coverage
The spatial or temporal topic of the resource, the spatial applicability of the resource, or the jurisdiction under which the resource is relevant
2025-10-17
Lassa
Public Health
R-Lead
R-T&E
Special Pathogens
Viral Hemorrhagic Fever
-
https://repository.netecweb.org/files/original/bf8b3a4a23c577f92132d95ff56c13b6.png
63b014390b5cc48d6ae58f4172428b34
Online Course
Access portal to an online course.
Duration
Length of time involved (seconds, minutes, hours, days, class periods, etc.)
Self-paced
Objectives
<strong>Aperçu</strong>: La fièvre de Lassa, une fièvre hémorragique virale avec des symptômes similaires à ceux de la maladie virale d'Ebola, est endémique dans une grande partie de l'Afrique de l'Ouest et provoque généralement une poussée saisonnière de décembre à mars. Les humains sont généralement infectés par le virus Lassa à la suite d'une exposition aux urines ou aux fèces de rats Mastomys infectés. Ce cours offre une introduction générale sur la fièvre de Lassa et s'adresse au personnel se préparant à répondre aux flambées de fièvre de Lassa (WHO).
URL
https://openwho.org/courses/fievre-de-lassa-introduction
Access
Description of access information (e.g. itunes).
Free Online
Dublin Core
The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.
Title
A name given to the resource
Fièvre de Lassa: Introduction
Subject
The topic of the resource
Contenu Français
Description
An account of the resource
Online course created by the WHO. This course is also available in <a href="https://repository.netecweb.org/items/show/292">English</a>.
Creator
An entity primarily responsible for making the resource
WHO
Date
A point or period of time associated with an event in the lifecycle of the resource
2018
Contributor
An entity responsible for making contributions to the resource
2024-03-27 R-Lead – never reviewed – make due in 6 months
Coverage
The spatial or temporal topic of the resource, the spatial applicability of the resource, or the jurisdiction under which the resource is relevant
2024-11-27
Français
French
Lassa
Public Health
R-Lead
Special Pathogens
Viral Hemorrhagic Fever
-
https://repository.netecweb.org/files/original/8df853d7cbf6e38897cc9822e2f157b2.png
1b6b01a22c0ec5517f95feb53db57c40
Dublin Core
The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.
Title
A name given to the resource
Discover
Description
An account of the resource
<div style="background-color:#c7e5f8;">
<h2 style="background-color:#c7e5f8;"><span style="font-size:80%;line-height:24px;"><a href="https://repository.netecweb.org/exhibits/show/ncov/ncov"><button>COVID-19 Update</button></a><a href="https://repository.netecweb.org/news#Map"><button>Outbreak Map</button></a><a href="https://repository.netecweb.org/news#News"><button>Newsfeed</button></a><a href="https://repository.netecweb.org/exhibits/show/monkeypox/monkeypox"><button>Monkeypox 2021</button></a><a href="https://repository.netecweb.org/exhibits/show/drcebola2018/drcebola2018"><button>2020 Ebola Update</button></a><a href="https://repository.netecweb.org/ebolatimeline"><button>Ebola Timeline</button></a><a href="https://repository.netecweb.org/exhibits/show/mers/mers"><button>MERS</button></a><a href="https://repository.netecweb.org/exhibits/show/aerosol/aerosol"><button>Airborne Transmission</button></a></span></h2>
<h2 style="background-color:#c7e5f8;">Discover Background Data and Resources:</h2>
<ul><li>
<p><span style="line-height:24px;">Get introduced to NETEC through the interactive timeline of special pathogens below.* This timeline describes some significant special pathogen events in recent history.</span></p>
</li>
<li>
<p><span style="line-height:24px;">Find out more about the 2014 Ebola outbreak and the development of the ASPR/CDC-supported network of healthcare facilities preparing for the next outbreak through <em><a href="/ebolatimeline"><button>the Ebola timeline</button></a>.</em></span></p>
</li>
</ul><ul><li>
<p><span style="line-height:24px;">This NETEC Repository helps to provide training and educational resources to prepare for future special pathogen events. </span></p>
</li>
</ul><ul><li>
<p><span style="line-height:24px;">Explore the files BELOW THE TIMELINE to <em><strong>discover and learn</strong></em> more about Ebola and other Special Pathogens, an overview of special pathogens, clinically managing patients affected, and readying healthcare teams and systems to keep everyone safe.</span></p>
</li>
</ul><h2 style="background-color:#c7e5f8;">Timeline of Special Pathogens:</h2>
<a href="#click">Skip timeline</a>
<p style="margin-bottom:0;"><iframe width="100%" height="635" style="border:1px solid #000000;" src="https://cdn.knightlab.com/libs/timeline3/latest/embed/index.html?source=1AQiHJEzkhEi71uIi7wTWWgSFRwR6wRbRyfhbASrw3Ig&font=Default&lang=en&initial_zoom=2&height=650" title="Timeline of Special Pathogens"></iframe></p>
<h2 style="background-color:#c7e5f8;"><span style="font-size:70%;">*Click for <a href="/timeline2access"><button>a screen reader accessible table of this timeline</button></a>. </span></h2>
</div>
Guide
Document providing operation or response information, general guidance documents.
URL
https://www.who.int/activities/prioritizing-diseases-for-research-and-development-in-emergency-contexts
Dublin Core
The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.
Title
A name given to the resource
Prioritizing diseases for research and development in emergency contexts
Subject
The topic of the resource
General
Description
An account of the resource
Worldwide, the number of potential pathogens is very large, while the resources for disease research and development (R&D) is limited. To ensure efforts under WHO’s R&D Blueprint are focused and productive, a list of diseases and pathogens are prioritized for R&D in public health emergency contexts.
Creator
An entity primarily responsible for making the resource
World Health Organization
Date
A point or period of time associated with an event in the lifecycle of the resource
2022
Coronavirus
Crimean Congo Haemorrhagic Fever (CCHF)
Ebola
Epidemic
Experimental Drugs
Lassa
Marburg
Medical Surveillance
MERS-CoV
Mpox
Orthopox Virus
Outbreaks
Pandemic
Plague
Prophylaxis
Public Health
R-Gen
Respiratory Pathogen
SARS
Special Pathogens
Therapeutics
Vaccine Study
Variola
Viral Hemorrhagic Fever